AMCG00018156 (prkar1b,LOC104941536)


Basic Information

Item Value
gene id AMCG00018156
gene name prkar1b,LOC104941536
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 2925415 ~ 2934755 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018156
GCGACGGGGCAGTGCTGGCCTCCTGCTGTCGGATCACAAGAGCTGCGTAACGCCGAGACCTGGGCAGGACTACCGAATGGCATGGAAGAATGCAAACAAATCTTGGCCCGTCAGAAGTCCAACTCCCAGTCGGACTCTCACGACGATGAGATCTCTCCCCCGCCTCCCAACCCAGTGGTGAAGGCCCGGCGCCGGAGGGGGGGGGTGAGCGCCGAGGTCTACACCGAGGAAGACGCCGTGTCCTACGTCAGGAAGGTAATACCAAAGGACTACAAAACGATGACAGCTCTGGCCAAGGCCATCTCCAAGAACGTGCTCTTTGCCCACCTTGATGACAACGAGAGAAGCAGGCCATTGCCTTTCTCAAACACAGGTGTGGTGATCCTGTGTTTCGGCATGAGCTCGGGCATCGCAGCCCCTCAGCCCGAGAACAAGCTGCCCTGA

Function

symbol description
prkar1b Predicted to enable cAMP binding activity; cAMP-dependent protein kinase inhibitor activity; and protein kinase A catalytic subunit binding activity. Predicted to be involved in negative regulation of cAMP-dependent protein kinase activity. Predicted to act upstream of or within regulation of protein phosphorylation. Predicted to be located in plasma membrane. Predicted to be part of cAMP-dependent protein kinase complex. Predicted to be active in cytoplasm. Orthologous to human PRKAR1B (protein kinase cAMP-dependent type I regulatory subunit beta).

NR:

description
PREDICTED: cAMP-dependent protein kinase type I-beta regulatory subunit isoform X2

GO:

id name namespace
GO:0045859 regulation of protein kinase activity biological_process
GO:0005952 cAMP-dependent protein kinase complex cellular_component
GO:0008603 cAMP-dependent protein kinase regulator activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018156 True 444 mRNA 0.59 4 2925415 2934755

Neighbor

gene id symbol gene type direction distance location
AMCG00018155 NA coding upstream 10074 2911621 ~ 2915341 (+)
AMCG00018148 NA coding upstream 43569 2879568 ~ 2881846 (+)
AMCG00018150 NA coding upstream 97645 2814447 ~ 2827770 (+)
AMCG00018149 LOC107753764,LOC107661878,LOC107718604 coding upstream 131542 2788373 ~ 2793873 (+)
AMCG00018144 NA coding upstream 138893 2783062 ~ 2786522 (+)
AMCG00018163 NA coding downstream 12679 2947434 ~ 2948696 (+)
AMCG00018158 prkar1b,LOC107653458,LOC107661853 coding downstream 15136 2949891 ~ 2965319 (+)
AMCG00018159 NA coding downstream 41980 2976735 ~ 2995555 (+)
AMCG00018166 NA coding downstream 170265 3105020 ~ 3122175 (+)
AMCG00018164 NA coding downstream 189865 3124620 ~ 3139596 (+)
G114629 NA non-coding upstream 42447 2882432 ~ 2882968 (+)
G114624 NA non-coding upstream 58178 2864988 ~ 2867237 (+)
G114613 NA non-coding upstream 79962 2844305 ~ 2845453 (+)
G114555 NA non-coding upstream 182729 2670907 ~ 2742686 (+)
G114553 NA non-coding upstream 256754 2668460 ~ 2668661 (+)
G114674 ubfd1 non-coding downstream 167411 3102166 ~ 3103170 (+)
G114699 NA non-coding downstream 233408 3168163 ~ 3168982 (+)
G114731 NA non-coding downstream 302288 3237043 ~ 3237244 (+)
G114806 NA non-coding downstream 1081323 4016078 ~ 4018982 (+)
G114867 NA non-coding downstream 1258587 4193342 ~ 4193996 (+)
G114551 NA other upstream 277641 2640846 ~ 2647774 (+)
G114518 NA other upstream 356477 2491313 ~ 2568938 (+)
AMCG00018119 tfap4,LOC107661646,LOC107718566,LOC107553667 other upstream 658640 2247853 ~ 2266775 (+)
AMCG00018106 NA other upstream 942849 1979046 ~ 1982566 (+)
G114330 NA other upstream 946688 1977004 ~ 1978727 (+)
AMCG00018196 NA other downstream 1251655 4186410 ~ 4193330 (+)
AMCG00018216 telo2 other downstream 1660178 4594933 ~ 4604105 (+)
G115049 NA other downstream 1826763 4761518 ~ 4763905 (+)
G115299 NA other downstream 3014708 5949463 ~ 5951017 (+)
AMCG00018272 NA other downstream 3220733 6155488 ~ 6160616 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) LOC110487025 LOC106606482 misc NC_048576.1 CM023230.2 88549729 ~ 88605377 (-)