AMCG00018410 (rac1a,rac1,LOC105026138,LOC107569188,LOC107596579,LOC106601744,LOC108437155)


Basic Information

Item Value
gene id AMCG00018410
gene name rac1a,rac1,LOC105026138,LOC107569188,LOC107596579,LOC106601744,LOC108437155
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 10029502 ~ 10041516 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018410
ATGCAGGCCATAAAGTGTGTGGTTGTCGGTGACGGAGCTGTGGGTAAAACATGCCTCCTGATCAGCTATACCACCAATGCATTCCCTGGGGAGTACATCCCCACCGTCTTCGACAACTACTCAGCAAATGTAATGGTTGATGGCAAGCCAGTGAACCTGGGGCTGTGGGATACTGCAGGACAGGAGGACTATGACAGACTGCGCCCCCTGTCTTACCCCCAGACGGATGTGTTCTTGATCTGTTTCTCCCTGGTGAGCCCAGCGTCTTTTGAAAACGTCCGAGCAAAGTGGTATCCTGAAGTGAGACACCATTGCCCAAACACTCCAATCATCCTTGTGGGTACCAAGCTTGATCTGAGAGACGACAAGGACACCATTGAGAAACTGAAGGAGAAGAAACTCACACCCATCACCTACCCCCAGGGCCTGGCCATGGCCAAAGAGATCGGTGCAGTGAAGTACCTGGAGTGCTCTGCTCTGACACAGCGTGGCCTTAAAACTGTGTTTGACGAAGCCATCCGGGCCGTTCTGTGCCCACCTCCAGTGAAGAAGACTAGGAGGAGGTGCAGGATATTCTAA

Function

symbol description
rac1a Predicted to enable GTP binding activity; GTPase activity; and protein kinase binding activity. Acts upstream of or within cell migration involved in gastrulation; myoblast fusion; and neutrophil chemotaxis. Predicted to be active in several cellular components, including cell cortex; cytoplasmic vesicle; and dendritic spine. Is expressed in liver; retina; and retinal ganglion cell layer. Human ortholog(s) of this gene implicated in autosomal dominant mental retardation 48; colon adenocarcinoma; and pancreatic adenocarcinoma. Orthologous to human RAC1 (Rac family small GTPase 1).
rac1 Enables GTP binding activity; GTPase activity; and enzyme binding activity. Involved in several processes, including plasma membrane bounded cell projection assembly; positive regulation of cellular component biogenesis; and regulation of cell migration. Acts upstream of or within actin cytoskeleton organization; positive regulation of lamellipodium assembly; and ruffle organization. Located in several cellular components, including recycling endosome membrane; ruffle membrane; and trans-Golgi network. Is extrinsic component of cytoplasmic side of plasma membrane. Is active in glutamatergic synapse and postsynapse. Colocalizes with actin filament. Implicated in autosomal dominant mental retardation 48; colon adenocarcinoma; and pancreatic adenocarcinoma. Biomarker of colon adenocarcinoma; colon adenoma; colorectal cancer; and pancreatic ductal adenocarcinoma.

NR:

description
PREDICTED: ras-related C3 botulinum toxin substrate 1

GO:

id name namespace
GO:0060071 Wnt signaling pathway, planar cell polarity pathway biological_process
GO:0072659 protein localization to plasma membrane biological_process
GO:0042074 cell migration involved in gastrulation biological_process
GO:0043552 positive regulation of phosphatidylinositol 3-kinase activity biological_process
GO:0045087 innate immune response biological_process
GO:0071542 dopaminergic neuron differentiation biological_process
GO:0021799 cerebral cortex radially oriented cell migration biological_process
GO:0045453 bone resorption biological_process
GO:0045740 positive regulation of DNA replication biological_process
GO:0034446 substrate adhesion-dependent cell spreading biological_process
GO:0003382 epithelial cell morphogenesis biological_process
GO:0002551 mast cell chemotaxis biological_process
GO:0021831 embryonic olfactory bulb interneuron precursor migration biological_process
GO:0007520 myoblast fusion biological_process
GO:0006954 inflammatory response biological_process
GO:0030168 platelet activation biological_process
GO:0031295 T cell costimulation biological_process
GO:0038095 Fc-epsilon receptor signaling pathway biological_process
GO:0038096 Fc-gamma receptor signaling pathway involved in phagocytosis biological_process
GO:0035025 positive regulation of Rho protein signal transduction biological_process
GO:0048532 anatomical structure arrangement biological_process
GO:0006972 hyperosmotic response biological_process
GO:0048813 dendrite morphogenesis biological_process
GO:0043065 positive regulation of apoptotic process biological_process
GO:0048261 negative regulation of receptor-mediated endocytosis biological_process
GO:0043652 engulfment of apoptotic cell biological_process
GO:0002093 auditory receptor cell morphogenesis biological_process
GO:0050690 regulation of defense response to virus by virus biological_process
GO:0090103 cochlea morphogenesis biological_process
GO:0045216 cell-cell junction organization biological_process
GO:0032707 negative regulation of interleukin-23 production biological_process
GO:0097178 ruffle assembly biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:0097190 apoptotic signaling pathway biological_process
GO:0008283 cell population proliferation biological_process
GO:0048011 neurotrophin TRK receptor signaling pathway biological_process
GO:0030838 positive regulation of actin filament polymerization biological_process
GO:0016601 Rac protein signal transduction biological_process
GO:0060263 regulation of respiratory burst biological_process
GO:0007411 axon guidance biological_process
GO:0001934 positive regulation of protein phosphorylation biological_process
GO:0030334 regulation of cell migration biological_process
GO:0016032 viral process biological_process
GO:0010310 regulation of hydrogen peroxide metabolic process biological_process
GO:0007160 cell-matrix adhesion biological_process
GO:0010592 positive regulation of lamellipodium assembly biological_process
GO:0071526 semaphorin-plexin signaling pathway biological_process
GO:0051668 localization within membrane biological_process
GO:0032587 ruffle membrane cellular_component
GO:0005802 trans-Golgi network cellular_component
GO:0005829 cytosol cellular_component
GO:0042470 melanosome cellular_component
GO:0000139 Golgi membrane cellular_component
GO:0019897 extrinsic component of plasma membrane cellular_component
GO:0001891 phagocytic cup cellular_component
GO:0030027 lamellipodium cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0030742 GTP-dependent protein binding molecular_function
GO:0019901 protein kinase binding molecular_function
GO:0051022 Rho GDP-dissociation inhibitor binding molecular_function
GO:0031996 thioesterase binding molecular_function

KEGG:

id description
K04392 RAC1; Ras-related C3 botulinum toxin substrate 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018410 True 579 mRNA 0.53 6 10029502 10041516

Neighbor

gene id symbol gene type direction distance location
AMCG00018408 NA coding downstream 14609 10004233 ~ 10014893 (-)
AMCG00018409 NA coding downstream 27352 9986174 ~ 10002150 (-)
AMCG00018404 kdelr2,LOC103354828,LOC102232388,LOC100710456,LOC107091462,LOC104935524 coding downstream 48506 9973285 ~ 9980996 (-)
AMCG00018403 NA coding downstream 69442 9944688 ~ 9960060 (-)
AMCG00018394 NA coding downstream 262654 9761500 ~ 9766848 (-)
AMCG00018417 NA coding upstream 106016 10147532 ~ 10150509 (-)
AMCG00018418 ccz1,LOC103028980 coding upstream 132904 10174420 ~ 10189358 (-)
AMCG00018421 pvalb8,LOC103030409,LOC108412252,LOC103372314,LOC107548708,LOC107691229,LOC103141687,LOC107724728 coding upstream 154693 10196209 ~ 10198405 (-)
AMCG00018419 LOC108273406,LOC108431966,LOC107724689 coding upstream 161263 10202779 ~ 10218488 (-)
AMCG00018420 NA coding upstream 182156 10223672 ~ 10231201 (-)
G116136 NA non-coding downstream 240923 9784430 ~ 9788579 (-)
G116065 NA non-coding downstream 501766 9527492 ~ 9527736 (-)
G116058 NA non-coding downstream 547350 9480910 ~ 9482152 (-)
G115949 NA non-coding downstream 813685 9200800 ~ 9215817 (-)
G115874 NA non-coding downstream 1167125 8861873 ~ 8862377 (-)
G116236 NA non-coding upstream 101909 10143425 ~ 10144599 (-)
G116255 NA non-coding upstream 121762 10163278 ~ 10163522 (-)
G116256 NA non-coding upstream 127732 10169248 ~ 10169622 (-)
G116352 NA non-coding upstream 567502 10609018 ~ 10671019 (-)
G116355 NA non-coding upstream 697035 10738551 ~ 10739008 (-)
G116165 NA other downstream 104920 9919046 ~ 9924582 (-)
AMCG00018390 snu13,LOC101154660,LOC105910236 other downstream 249957 9774306 ~ 9779545 (-)
AMCG00018364 ubald1,LOC105031098,LOC105928896,LOC106589553,LOC103131586 other downstream 771300 9239812 ~ 9258202 (-)
AMCG00018339 NA other downstream 1352694 8666737 ~ 8676808 (-)
AMCG00018344 NA other downstream 1380695 8641896 ~ 8648807 (-)
AMCG00018416 usp42 other upstream 79083 10120599 ~ 10136769 (-)
AMCG00018424 tecpr1,LOC102784946,LOC103372311 other upstream 261538 10303054 ~ 10332982 (-)
G116306 NA other upstream 293685 10335201 ~ 10342089 (-)
G116307 LOC108412765,LOC107713954,LOC107665916,LOC107691223,LOC107548703 other upstream 318613 10360129 ~ 10385216 (-)
AMCG00018431 trrap other upstream 521038 10562554 ~ 10580105 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000112_03291919_03299963 RAC3B, RAC3, RAC3A, RAC1, RAC1A, RAC1B, RAC3.S, RAC1.L coding CI01000112 null 3291241 ~ 3299963 (-)
tiger barb (Puntius tetrazona) G3602 NA non-coding NC_056699.1 CM032068.1 15518183 ~ 15518572 (-)