G37455



Basic Information


Item Value
gene id G37455
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030124.1
NCBI id CM030124.1
chromosome length 51038645
location 45980819 ~ 45981041 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU46779
tgacccaaaacacacagccaaggcaacaaaggagtggctcaagaagaagcacattaaggtcctggagtggcctagccagtctccagaccttaatcccatagaaaatctgtggagggagctgaaggttcgagttgccaaacgtcagccttgaaaccttaatgacttggagaggatctgcaaagaggagtgggacaaaatccctcctgagatgtgtgcaaacctt

Function


NR:

description
PREDICTED: G-protein coupled receptor 98

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
TU46779 True 223 lncRNA 0.49 1 45980819 45981041

Neighbor


gene id symbol gene type direction distance location
AMCG00019804 NA coding upstream 721860 45257308 ~ 45258959 (+)
AMCG00019803 NA coding upstream 743418 45206216 ~ 45237401 (+)
AMCG00019796 rala,LOC103042957,LOC105025131,LOC107565693 coding upstream 806901 45158209 ~ 45173918 (+)
AMCG00019798 NA coding upstream 915531 45064638 ~ 45065288 (+)
AMCG00019797 NA coding upstream 1045210 44925531 ~ 44935609 (+)
AMCG00019812 LOC106590186 coding downstream 683166 46664207 ~ 46771569 (+)
AMCG00019811 NA coding downstream 842205 46823246 ~ 46836213 (+)
AMCG00019814 NA coding downstream 860407 46841448 ~ 46844186 (+)
AMCG00019810 NA coding downstream 868878 46849919 ~ 46861698 (+)
AMCG00019817 NA coding downstream 1087955 47068996 ~ 47069748 (+)
G37440 NA non-coding upstream 158698 45819485 ~ 45822121 (+)
G37373 NA non-coding upstream 696424 45284121 ~ 45284395 (+)
G37335 NA non-coding upstream 815694 45160708 ~ 45165125 (+)
G37300 NA non-coding upstream 1005393 44952385 ~ 44975426 (+)
G37274 NA non-coding upstream 1044063 44884806 ~ 44936756 (+)
G37486 LOC107575789 non-coding downstream 384286 46365327 ~ 46393098 (+)
G37514 NA non-coding downstream 564130 46545171 ~ 46546349 (+)
G37516 NA non-coding downstream 567774 46548815 ~ 46550555 (+)
G37521 NA non-coding downstream 574149 46555190 ~ 46565098 (+)
G37524 NA non-coding downstream 591260 46572301 ~ 46572798 (+)
G37372 sugct,LOC107687505 other upstream 410882 45279455 ~ 45569937 (+)
AMCG00019785 NA other upstream 1537063 44435922 ~ 44443756 (+)
G37105 ssr1 other upstream 1924216 44053074 ~ 44056603 (+)
G36954 NA other upstream 2647506 43330292 ~ 43333313 (+)
AMCG00019758 NA other upstream 2709627 43261894 ~ 43271192 (+)
G37561 LOC100136012 other downstream 809986 46791027 ~ 46791485 (+)
AMCG00019820 efr3a other downstream 1641727 47622768 ~ 47658001 (+)
G37779 NA other downstream 2469587 48450628 ~ 48451167 (+)
G37962 NA other downstream 3577441 49558482 ~ 49561383 (+)
G37964 NA other downstream 3581853 49562894 ~ 49563214 (+)

Expression



Co-expression Network