G63433


Basic Information

Item Value
gene id G63433
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 20563817 ~ 20580433 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU79378
TTCTCCCCCAGTCTTAACTTTCGCATAGTTCTTAGAGCTCTCCTGTACTGTTCAACTAGCTGTTTGTAATATATGGACATGTATATCTCTCACAGGTGAAGGAGGATGTTTTAAGTGCCTGGGTGTTACGTCTATGCAGGCAGCTCTTAGCTTGCTGGTTACACCTAACTGCAAGGCCCTGACTAATGAAGACTACTGCCAAAGCAGCTTGATTTAATATCACAGTGTAATACTATAGGTTCAATTCTGGGTCCAGGAGATGTGACTCTG

Function

GO: NA

KEGG:

id description
ko02010 ABC transporters
ko04976 Bile secretion
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU79378 True 270 lncRNA 0.43 3 20563817 20580433

Neighbor

gene id symbol gene type direction distance location
AMCG00020459 phkb coding upstream 37595 20501491 ~ 20526222 (+)
AMCG00020458 phkb,LOC107591034,LOC107723134,LOC107757780,LOC107598686 coding upstream 73820 20467388 ~ 20489997 (+)
AMCG00020444 NA coding upstream 253128 20300013 ~ 20310689 (+)
AMCG00020445 NA coding upstream 303156 20255777 ~ 20260661 (+)
AMCG00020443 NA coding upstream 326176 20235596 ~ 20237641 (+)
AMCG00020460 NA coding downstream 54433 20634866 ~ 20658252 (+)
AMCG00020461 NA coding downstream 81240 20661673 ~ 20672190 (+)
AMCG00020468 NA coding downstream 1450692 22031125 ~ 22047368 (+)
AMCG00020469 LOC106587286,LOC106561986,LOC107704827,LOC107681497 coding downstream 1513885 22094318 ~ 22097040 (+)
AMCG00020467 NA coding downstream 1537420 22117853 ~ 22121079 (+)
G63360 NA non-coding upstream 250545 20311699 ~ 20313272 (+)
G63334 vps35,LOC107659455,LOC107598694 non-coding upstream 311860 20248832 ~ 20251957 (+)
G63328 NA non-coding upstream 322891 20238830 ~ 20240926 (+)
G63318 NA non-coding upstream 366390 20197177 ~ 20197427 (+)
G63313 NA non-coding upstream 695535 19867785 ~ 19868282 (+)
G63448 NA non-coding downstream 503684 21084117 ~ 21084538 (+)
G63477 NA non-coding downstream 1058563 21638996 ~ 21639656 (+)
G63562 NA non-coding downstream 1627275 22207708 ~ 22208031 (+)
G63564 NA non-coding downstream 1771740 22352173 ~ 22382491 (+)
G63589 fam96b,LOC106562058 non-coding downstream 1773585 22354018 ~ 22354979 (+)
AMCG00020438 NA other upstream 927596 19631325 ~ 19636221 (+)
AMCG00020439 LOC107696663,LOC107556242,LOC107746488,LOC107726063 other upstream 961493 19597203 ~ 19602324 (+)
G63045 NA other upstream 2229785 18332569 ~ 18334032 (+)
AMCG00020407 NA other upstream 2491766 18067787 ~ 18072051 (+)
AMCG00020408 NA other upstream 2498028 18058558 ~ 18065789 (+)
AMCG00020470 NA other downstream 1554935 22135368 ~ 22142198 (+)
AMCG00020487 NA other downstream 1775741 22356174 ~ 22409493 (+)
AMCG00020505 NA other downstream 2473365 23053798 ~ 23062149 (+)
G63786 znf821,LOC107747380 other downstream 2489978 23070411 ~ 23074945 (+)
AMCG00020529 LOC107090538 other downstream 3452604 24033037 ~ 24068457 (+)

Expression


Co-expression Network