AMCG00021601 (ferd3l)


Basic Information

Item Value
gene id AMCG00021601
gene name ferd3l
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 22595630 ~ 22596109 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021601
ATGGAGGTCCAAGGAGCGTTTCTGGATGCTCCAGTTATGGACTTTGTCTCAGACTTCAACTTCTTGGACCTGCCTCTGAAGTCGAGCCCCGAATCGAAACCAAACGCAGCCACGTCTCTGCACAGCTTGGAGTTACGATACTATGACCTGGCTTCAGATCCTGCCATTGGGGATGGAGCCGTCCCCGGGTCTCCGTGCTCGCTGGGGATGGATGACAGCCCCCGGTATGGCATGGGCTCCCTGACGGGCAGGTCTAAGAGGAGACGGGTGGTCACCTCTGCCCAGCGCCAGGCCGCCAACATCAGGGAGAGGAGACGGATGTTCAGCCTCAATGAAGCTTTCGACGAGCTGCGCAAGAAGGTGCCCACCTTCGCCTACGAGAAGCGCCTGTCCCGGATTGAAACCCTCCGTCTCGCCATCGTCTATATATCCTTTATGACTGATCTGCTGGAGGAGGACGAGAGTGAGACTAAAAACTGA

Function

symbol description
ferd3l Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in developmental process and regulation of transcription by RNA polymerase II.

NR:

description
PREDICTED: fer3-like protein

GO: NA

KEGG:

id description
K22400 FERD3L; Fer3-like protein

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021601 True 480 mRNA 0.57 1 22595630 22596109

Neighbor

gene id symbol gene type direction distance location
AMCG00021600 twist1 coding downstream 6828 22587333 ~ 22588802 (-)
AMCG00021594 snx13 coding downstream 158748 22414264 ~ 22436882 (-)
AMCG00021592 agr2 coding downstream 289203 22303644 ~ 22306427 (-)
AMCG00021588 ankmy2,LOC102794045 coding downstream 348828 22242229 ~ 22246802 (-)
AMCG00021589 NA coding downstream 353942 22240700 ~ 22241688 (-)
AMCG00021598 NA coding upstream 38595 22634704 ~ 22638390 (-)
AMCG00021599 tmem196,LOC107655099,LOC107571147,LOC107755951 coding upstream 48283 22644392 ~ 22649062 (-)
AMCG00021597 NA coding upstream 77434 22673543 ~ 22682139 (-)
AMCG00021603 sp8,sp8b,LOC101158882 coding upstream 126830 22722939 ~ 22724339 (-)
AMCG00021607 NA coding upstream 305476 22901585 ~ 22907039 (-)
G86997 NA non-coding downstream 407490 22130806 ~ 22188140 (-)
G86925 NA non-coding downstream 810496 21784876 ~ 21785134 (-)
G86893 NA non-coding downstream 1079396 21516032 ~ 21516234 (-)
G86881 NA non-coding downstream 1301727 21291373 ~ 21293903 (-)
G86850 NA non-coding downstream 1404698 21189839 ~ 21190932 (-)
G87092 NA non-coding upstream 32490 22628599 ~ 22628891 (-)
G87116 NA non-coding upstream 94499 22690608 ~ 22690889 (-)
G87181 NA non-coding upstream 411285 23007394 ~ 23014782 (-)
G87193 NA non-coding upstream 479525 23075634 ~ 23076015 (-)
G87203 NA non-coding upstream 493493 23089602 ~ 23091111 (-)
AMCG00021569 NA other downstream 924315 21666402 ~ 21671315 (-)
G86808 NA other downstream 1512060 21063858 ~ 21083570 (-)
AMCG00021534 bet1,LOC107669829,LOC107722155 other downstream 1870750 20721884 ~ 20724880 (-)
G86649 NA other downstream 2197847 20395612 ~ 20397783 (-)
G86640 NA other downstream 2235375 20358301 ~ 20360255 (-)
AMCG00021619 NA other upstream 559078 23155187 ~ 23160991 (-)
AMCG00021630 NA other upstream 733216 23329325 ~ 23332968 (-)
G87263 NA other upstream 742142 23338251 ~ 23338484 (-)
AMCG00021634 NA other upstream 898916 23495025 ~ 23498761 (-)
AMCG00021662 NA other upstream 1603427 24199536 ~ 24210205 (-)

Expression


Co-expression Network