G3391


Basic Information

Item Value
gene id G3391
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 6001795 ~ 6002020 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU3777
GGGTGAAGGACACTATAGTTCATTTATGTAAGTGAGGATAGCAAAATAAAGTAAACTGTGACATATCATACCCAAAAATTCTTCATACTGTAGACTACCAGTAAAAGTGATAAAAATTTGGGACCAAAAATTATTCAGACACTTTGACCTGACCATGTTTTGCTTAAGTGTTATCTGACATAATTAAAATTATTTTTTTCTGACACAGTTTAACTCTGAGTTCTTG

Function

NR:

description
PREDICTED: G patch domain and ankyrin repeat-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU3777 True 226 lncRNA 0.33 1 6001795 6002020

Neighbor

gene id symbol gene type direction distance location
CI01000000_05992362_05993043 NA coding upstream 6988 5991447 ~ 5994807 (+)
CI01000000_05829574_05832335 SHISA3 coding upstream 168946 5829574 ~ 5832849 (+)
CI01000000_05786612_05788178 TM179 coding upstream 212583 5786612 ~ 5789212 (+)
CI01000000_05772514_05781160 NA coding upstream 220335 5771668 ~ 5781460 (+)
CI01000000_05754551_05762914 EHD1B coding upstream 238399 5753135 ~ 5763396 (+)
CI01000000_06020887_06024866 GRHPR, GRHPRA coding downstream 18867 6020887 ~ 6024921 (+)
CI01000000_06026678_06027850 NA coding downstream 24305 6026325 ~ 6027850 (+)
CI01000000_06590891_06591948 NA coding downstream 588286 6590306 ~ 6591967 (+)
CI01000000_06594095_06603856 ADHX, ADH5 coding downstream 592075 6594095 ~ 6603996 (+)
CI01000000_06849632_06863920 PCDH10B, PCDH10, PCDH10A coding downstream 847612 6849632 ~ 6864585 (+)
G3386 NA non-coding upstream 16277 5985299 ~ 5985518 (+)
G3382 NA non-coding upstream 21463 5975869 ~ 5980332 (+)
G3286 NA non-coding upstream 203082 5798495 ~ 5798713 (+)
G3278 NA non-coding upstream 282609 5718931 ~ 5719186 (+)
G3196 NA non-coding upstream 288692 5695181 ~ 5713103 (+)
G3396 NA non-coding downstream 32725 6034745 ~ 6035066 (+)
G3769 NA non-coding downstream 94427 6096447 ~ 6096670 (+)
G3815 NA non-coding downstream 214584 6216604 ~ 6242576 (+)
G4004 NA non-coding downstream 502916 6504936 ~ 6505206 (+)
G4008 NA non-coding downstream 510536 6512556 ~ 6512759 (+)
G2850 NA other upstream 1275313 4725986 ~ 4726482 (+)
G2774 NA other upstream 1547563 4453778 ~ 4454232 (+)
G579 NA other upstream 4092987 1767917 ~ 1908808 (+)
G435 NA other upstream 4568941 1425121 ~ 1432854 (+)
G350 NA other upstream 5324858 671842 ~ 676937 (+)
G6811 NA other downstream 4202811 10204831 ~ 10321679 (+)
G6820 NA other downstream 4425203 10427223 ~ 10433018 (+)
G7018 NA other downstream 4976469 10978489 ~ 10980872 (+)
G7153 NA other downstream 5242437 11244457 ~ 11245633 (+)
G7514 NA other downstream 6134502 12136522 ~ 12137008 (+)

Expression


Co-expression Network