G18798


Basic Information

Item Value
gene id G18798
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10020103 ~ 10020323 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21111
CAAGTTTTAAATAGGAAAAATATTGAAACTCTTTGGTCATTTTTGAGCGAGATGCTAACGGTCTAATCAGATTCAATGAACTATGCTAAGCTATGCTAAAAGTGGTACCGCCAGACCCGGAGATTGGCTGAATGGATTCGAAAACGGTAAAACTCAACTGTTTAACTCTAGGGGAGTTGGAAAATGAGCCTTTTTTCAAAAAAAGTGGAGTGTTCCTTTAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21111 True 221 lncRNA 0.56 1 10020103 10020323

Neighbor

gene id symbol gene type direction distance location
CI01000001_09946111_09958162 NA coding upstream 61857 9944120 ~ 9958246 (+)
CI01000001_09932205_09934551 NA coding upstream 84931 9931155 ~ 9935172 (+)
CI01000001_09782626_09784851 NA coding upstream 234919 9782626 ~ 9785184 (+)
CI01000001_09582178_09593275 PTPN22 coding upstream 426820 9582178 ~ 9593283 (+)
CI01000001_09533674_09538902 NA coding upstream 481024 9533674 ~ 9539079 (+)
CI01000001_10072627_10081119 CACNB3, CACNB3A, CACNB3B coding downstream 52304 10072627 ~ 10081179 (+)
CI01000001_10093069_10104108 RND1B, RND1, RND1A coding downstream 72579 10092902 ~ 10105699 (+)
CI01000001_10141190_10146911 PTGES3, PTGES3A coding downstream 120867 10141190 ~ 10148058 (+)
CI01000001_10150798_10152858 MIPA coding downstream 130050 10150373 ~ 10152938 (+)
CI01000001_10321783_10325266 NA coding downstream 301324 10321647 ~ 10325305 (+)
G17753 NA non-coding upstream 46786 9971792 ~ 9973317 (+)
G17751 NA non-coding upstream 53434 9963911 ~ 9966669 (+)
G17713 NA non-coding upstream 132947 9885585 ~ 9887156 (+)
G17709 NA non-coding upstream 157029 9855475 ~ 9863074 (+)
G17710 NA non-coding upstream 162921 9855862 ~ 9857182 (+)
G18804 NA non-coding downstream 3406 10023729 ~ 10023956 (+)
G18805 NA non-coding downstream 4405 10024728 ~ 10025029 (+)
G18807 NA non-coding downstream 5879 10026202 ~ 10026427 (+)
G18817 NA non-coding downstream 9131 10029454 ~ 10029691 (+)
G18818 NA non-coding downstream 11195 10031518 ~ 10031725 (+)
CI01000001_09435836_09436037 NA other upstream 582040 9435836 ~ 9436373 (+)
G17354 NA other upstream 779426 9234463 ~ 9240677 (+)
G17353 NA other upstream 791244 9216022 ~ 9228859 (+)
G17234 NA other upstream 1987620 8032124 ~ 8032483 (+)
CI01000001_07531945_07539781 NA other upstream 2479517 7531541 ~ 7540586 (+)
G18896 NA other downstream 219577 10239900 ~ 10241492 (+)
G18873 NA other downstream 236789 10223879 ~ 10260714 (+)
G18872 NA other downstream 250823 10271146 ~ 10281369 (+)
CI01000001_10395420_10396473 NA other downstream 373234 10394851 ~ 10396705 (+)
G18937 NA other downstream 454661 10474984 ~ 10476389 (+)

Expression


Co-expression Network