Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G22734

Basic Information

Item	Value
gene id	G22734
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000003
NCBI id	null
chromosome length	2831192
location	293004 ~ 293209 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU25652
TCCAATCTTACATGAGCGGTCTCTAGACTAACGCGCTCTCATGACAGCTGACGGCTGTGTGACGCGTGCTCCATAACACCCAGCAACTCGTCATACGCGTGGCAGAGCGGCGGCGAGAGCTCGGATGTCTTCTCTTGCTCTTTCTGTATGATGTCAGCAAAGCACTGTCTGCTGATCCTGAGGATGCAAGAGAGAATGCATTTTCA

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU25652	True	206	lncRNA	0.24	1	293004	293209

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000003_00228735_00265553	MB21D2	coding	downstream	27451	228668 ~ 265553 (-)
CI01000003_00196906_00197323	NA	coding	downstream	95681	196745 ~ 197323 (-)
CI01000003_00076297_00077678	NA	coding	downstream	215204	76270 ~ 77800 (-)
CI01000003_00074301_00075497	NA	coding	downstream	217507	74301 ~ 75497 (-)
CI01000003_00301515_00302754	NA	coding	upstream	8306	301515 ~ 302902 (-)
CI01000003_00364162_00366637	NA	coding	upstream	70872	364081 ~ 366637 (-)
CI01000003_00388122_00389931	DUSP28	coding	upstream	94913	388122 ~ 390027 (-)
CI01000003_00410927_00411601	SFT2D3	coding	upstream	117360	410569 ~ 412508 (-)
CI01000003_00418856_00424844	NA	coding	upstream	125268	418477 ~ 425969 (-)
G22733	NA	non-coding	downstream	25562	267190 ~ 267442 (-)
G22731	NA	non-coding	downstream	26272	266354 ~ 266732 (-)
G22713	NA	non-coding	downstream	104625	153642 ~ 188379 (-)
G22728	NA	non-coding	downstream	164744	121680 ~ 128260 (-)
G22737	NA	non-coding	upstream	2746	295955 ~ 296164 (-)
G22743	NA	non-coding	upstream	19288	312497 ~ 312705 (-)
G22745	NA	non-coding	upstream	23906	317115 ~ 317317 (-)
G22756	NA	non-coding	upstream	44843	338052 ~ 338262 (-)
G22767	NA	non-coding	upstream	84396	377605 ~ 377892 (-)
G22716	NA	other	downstream	223260	50512 ~ 69744 (-)

Expression

Co-expression Network