Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU25652

Basic Information

Item	Value
RNA id	TU25652
length	206
lncRNA type	inter_gene
GC content	0.24
exon number	1
gene id	G22734
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000003
NCBI id	null
chromosome length	2831192
location	293004 ~ 293209 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

TCCAATCTTACATGAGCGGTCTCTAGACTAACGCGCTCTCATGACAGCTGACGGCTGTGTGACGCGTGCTCCATAACACCCAGCAACTCGTCATACGCGTGGCAGAGCGGCGGCGAGAGCTCGGATGTCTTCTCTTGCTCTTTCTGTATGATGTCAGCAAAGCACTGTCTGCTGATCCTGAGGATGCAAGAGAGAATGCATTTTCA

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU25651	lncRNA	downstream	25562	267190 ~ 267442 (-)	True	G22733
TU25649	lncRNA	downstream	26272	266354 ~ 266732 (-)	True	G22731
TU25629	lncRNA	downstream	104625	153642 ~ 188379 (-)	True	G22713
TU25646	lncRNA	downstream	164744	121680 ~ 128260 (-)	True	G22728
TU25655	lncRNA	upstream	2746	295955 ~ 296164 (-)	True	G22737
TU25661	lncRNA	upstream	19288	312497 ~ 312705 (-)	True	G22743
TU25663	lncRNA	upstream	23906	317115 ~ 317317 (-)	True	G22745
TU25675	lncRNA	upstream	44843	338052 ~ 338262 (-)	True	G22756
TU25686	lncRNA	upstream	84396	377605 ~ 377892 (-)	True	G22767
CI01000003_00228735_00265553.mRNA	mRNA	downstream	27451	228668 ~ 265553 (-)	True	CI01000003_00228735_00265553
CI01000003_00196906_00197323.mRNA	mRNA	downstream	95681	196745 ~ 197323 (-)	True	CI01000003_00196906_00197323
CI01000003_00076297_00077678.mRNA	mRNA	downstream	215204	76270 ~ 77800 (-)	True	CI01000003_00076297_00077678
CI01000003_00074301_00075497.mRNA	mRNA	downstream	217507	74301 ~ 75497 (-)	True	CI01000003_00074301_00075497
CI01000003_00301515_00302754.mRNA	mRNA	upstream	8306	301515 ~ 302902 (-)	True	CI01000003_00301515_00302754
CI01000003_00364162_00366637.mRNA	mRNA	upstream	70872	364081 ~ 366637 (-)	True	CI01000003_00364162_00366637
CI01000003_00388122_00389931.mRNA	mRNA	upstream	94913	388122 ~ 390027 (-)	True	CI01000003_00388122_00389931
CI01000003_00410927_00411601.mRNA	mRNA	upstream	117360	410569 ~ 412508 (-)	True	CI01000003_00410927_00411601
CI01000003_00418856_00424844.mRNA	mRNA	upstream	125268	418477 ~ 425969 (-)	True	CI01000003_00418856_00424844
TU25632	other	downstream	223260	50512 ~ 69744 (-)	True	G22716

Expression Profile