G27013


Basic Information

Item Value
gene id G27013
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 4042830 ~ 4043074 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU30486
GAAATAGTGTACACTTCACAATAAGGTTCACAAATTCCATTAATGAATGCTTTGTTGAATTTAAATAATGATAGTAAAGTGCATATAAACATGAACAACATATCTGTTAATGTTTAGATGGTTTCCACTTCAGAATTATGTTTACAGCCCAAATCTATGCCTTGTTAATAAATAATGCTGATAAGGTACACAATGGCATTTTTACCTTTAGTGTGAGTGGTGAGTTAGAAATGTGTCAACTGCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU30486 True 245 lncRNA 0.47 1 4042830 4043074

Neighbor

gene id symbol gene type direction distance location
CI01000004_03934726_03935639 NA coding upstream 106960 3933685 ~ 3935870 (+)
CI01000004_03878083_03909016 NA coding upstream 133521 3878019 ~ 3909309 (+)
CI01000004_03814120_03839793 NA coding upstream 203023 3814051 ~ 3839807 (+)
CI01000004_03735876_03736152 NA coding upstream 305813 3735754 ~ 3737017 (+)
CI01000004_03592655_03592917 NA coding upstream 449913 3592655 ~ 3592917 (+)
CI01000004_04048829_04053849 NA coding downstream 2854 4045928 ~ 4054570 (+)
CI01000004_04123289_04123846 NA coding downstream 79550 4122624 ~ 4123963 (+)
CI01000004_04172679_04173047 PBX1 coding downstream 128580 4171654 ~ 4174352 (+)
CI01000004_04231304_04239652 NA coding downstream 188137 4231211 ~ 4240123 (+)
CI01000004_04315741_04317415 GLULB, GLULA, GLNA, GS02, GLUL, GS01, GS04 coding downstream 271702 4314776 ~ 4317616 (+)
G27010 NA non-coding upstream 4280 4038283 ~ 4038550 (+)
G27009 NA non-coding upstream 4682 4037923 ~ 4038148 (+)
G27008 NA non-coding upstream 6308 4036247 ~ 4036522 (+)
G26525 NA non-coding upstream 49904 3992653 ~ 3992926 (+)
G26522 NA non-coding upstream 53950 3988528 ~ 3988880 (+)
G27018 NA non-coding downstream 16843 4059917 ~ 4060234 (+)
G27020 NA non-coding downstream 20323 4063397 ~ 4072269 (+)
G27022 NA non-coding downstream 34028 4077102 ~ 4077398 (+)
G27023 NA non-coding downstream 34492 4077566 ~ 4077785 (+)
G27024 NA non-coding downstream 35197 4078271 ~ 4078586 (+)
CI01000004_03550525_03552621 PTGER4C other upstream 490384 3550329 ~ 3553423 (+)
G26245 NA other upstream 520437 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 1283892 2745885 ~ 2769135 (+)
G25992 NA other upstream 1306062 2736536 ~ 2736768 (+)
G25882 NA other upstream 1469781 2548075 ~ 2573049 (+)
G27805 NA other downstream 1329751 5372825 ~ 5373803 (+)
G28165 NA other downstream 1689515 5732589 ~ 5733001 (+)
G28302 NA other downstream 2426954 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 2528146 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 3611698 7654234 ~ 7656383 (+)

Expression


Co-expression Network