G54087 (mybpc3,LOC107740474,LOC107670721,LOC107554890)


Basic Information

Item Value
gene id G54087
gene name mybpc3,LOC107740474,LOC107670721,LOC107554890
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056705.1
NCBI id CM032074.1
chromosome length 41700998
location 18055593 ~ 18056537 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU80225
CCTTTAACAAAGAGCTCAGTGACGGTCTTCTCTTCTCCAATCACGCATGTATAAGCAGCATCATCTGCCAGAGTACAGTTGTTGATAGTGAGGAAGCGTTTGTTGCCTACACTTTCAAAGATGTACCTGCTTCCTGTTGGGTGTATCTCTTGTCCATTTTTTAGCCATTTAACCTCTGCGTCTGCATTTGCCACTTCAATTTGCAATTTGATCTTGTGTCCCTTTTCCACTTGGTAAGCTGGGTCCAGCTTTCTCAGAAATGCTG

Function

symbol description
mybpc3 Predicted to enable myosin heavy chain binding activity. Acts upstream of or within cardiac chamber morphogenesis and regulation of heart rate. Is expressed in anterior macula; heart rudiment; musculature system; pericardial region; and trunk. Human ortholog(s) of this gene implicated in familial hypertrophic cardiomyopathy; hypertrophic cardiomyopathy; and hypertrophic cardiomyopathy 4. Orthologous to human MYBPC3 (myosin binding protein C3).

NR:

description
PREDICTED: myosin-binding protein C, cardiac-type-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU80225 True 265 lncRNA 0.44 2 18055593 18056537

Neighbor

gene id symbol gene type direction distance location
cars1 cars,LOC107740410,LOC107700453,LOC107670769,LOC107755065 coding downstream 11036 18031143 ~ 18044557 (-)
nap1l4b nap1l4,nap1l4b,LOC107700452,LOC107670756 coding downstream 25037 18021292 ~ 18030556 (-)
igdcc4 igdcc4,LOC107670755,LOC107700451,LOC107595068,LOC107755063,LOC107554907,LOC107750477 coding downstream 41418 17960383 ~ 18014175 (-)
igdcc3 igdcc3,LOC107750478,LOC107670768,LOC107755062,LOC107700450,LOC107554891 coding downstream 98013 17888607 ~ 17957580 (-)
LOC122348815 cilp,LOC107554910,LOC107750479,LOC107670750,LOC107700449,LOC107755059,LOC107595070 coding downstream 192351 17856741 ~ 17863242 (-)
lin7c lin7c,LOC107755067,LOC107595064,LOC107091323,LOC108432380 coding upstream 19220 18075757 ~ 18083092 (-)
bdnf bdnf,LOC107554894,LOC107595107,LOC107700392,LOC107670730 coding upstream 28964 18085501 ~ 18102199 (-)
kif18a kif18a,LOC107554904,LOC107740412,LOC107670760,LOC107700457,LOC107755033,LOC107595063 coding upstream 60554 18117091 ~ 18138373 (-)
LOC122349713 arl14ep,LOC107663944,LOC107740492,LOC107554899,LOC107700465,LOC107755038 coding upstream 340485 18397022 ~ 18400506 (-)
LOC122348011 LOC107749239,LOC107663077,LOC107574829,LOC107573432 coding upstream 467193 18523730 ~ 18527780 (-)
G53983 NA non-coding downstream 419574 17632003 ~ 17636019 (-)
G53974 NA non-coding downstream 428273 17627121 ~ 17627320 (-)
G53970 NA non-coding downstream 446235 17609153 ~ 17609358 (-)
G53969 NA non-coding downstream 446551 17608836 ~ 17609042 (-)
G53965 NA non-coding downstream 446988 17608346 ~ 17608605 (-)
G54093 NA non-coding upstream 14114 18070651 ~ 18074482 (-)
G54104 NA non-coding upstream 82116 18138653 ~ 18138939 (-)
LOC122349130 NA non-coding upstream 304379 18360916 ~ 18386011 (-)
G54283 NA non-coding upstream 332669 18389206 ~ 18390530 (-)
G54292 NA non-coding upstream 485139 18541676 ~ 18578093 (-)
serf2b NA other downstream 1007552 17046444 ~ 17048041 (-)
G53797 tpm1,LOC103462590 other downstream 1121341 16881893 ~ 16934252 (-)
nrn1lb nrn1lb,LOC107750645,LOC107586039,LOC107594653,LOC107741430 other downstream 1491255 16560418 ~ 16564338 (-)
rnaseka rnaseka,rnasek,LOC107750577,LOC107561913,LOC107678101,LOC107749794,LOC107594736,LOC107669181 other downstream 3080425 14973703 ~ 14975168 (-)
G52917 LOC105896813 other downstream 3910313 14144506 ~ 14145280 (-)
LOC122349446 arl14ep,LOC107663944,LOC107740492,LOC107554899,LOC107700465,LOC107755038 other upstream 609736 18666273 ~ 18669833 (-)
G54312 LOC107663979,LOC107557712,LOC107740422,LOC107700467,LOC107553073,LOC107755077,LOC108430810 other upstream 685623 18742160 ~ 18794207 (-)
G54330 LOC107557708,LOC107553077,LOC107740430,LOC107700368 other upstream 789739 18846276 ~ 19291166 (-)
LOC122348206 tph1b,LOC107740493,LOC107557706,LOC107663941,LOC107553080,LOC108430795 other upstream 853111 18909648 ~ 18914921 (-)
G54377 mns1,LOC107755086,LOC107553079,LOC107740431,LOC107663983 other upstream 1255111 19311648 ~ 19312124 (-)

Expression


Co-expression Network