G31778


Basic Information

Item Value
gene id G31778
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 11950993 ~ 11951357 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU36021
AAATATTCATAACTTTAAAAACTTAAATAACTGGCTTCCGGCAGAAGGCCGTACGCACGTCAACTTAGCAAGCCAAAAGAGTAGCCCCTGAAGCGACGTAGGAGTAACGTAAGCTTAGACACTCTCGCTGTTCAAACAAAAAGGGCTGGCAACAAACTCAAGCTCCTCTTCTCTTATATAGAAATCCTCTGATAAAAATTCTTATTTTAGACTTCTAATTCGTGACCGGTGTTTTGTTTTGCTCTCTCCTCCACGTTCGTCATTACATCATGCGTCAGGTCAGAGTTCACTAAATTGATGCGTAGGGCCGTCTGTCGGAAGCTAGTTATTTTCGTTTTTAAAGTTTTAAATATGGATATTTTTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU36021 True 365 lncRNA 0.40 1 11950993 11951357

Neighbor

gene id symbol gene type direction distance location
CI01000004_11897082_11898506 MYCB coding upstream 51778 11896232 ~ 11899215 (+)
CI01000004_11863724_11890961 NA coding upstream 59879 11863724 ~ 11891114 (+)
CI01000004_11776595_11786233 STARD3NL coding upstream 164076 11776419 ~ 11786917 (+)
CI01000004_11771176_11773391 EPDR1 coding upstream 177477 11771089 ~ 11773516 (+)
CI01000004_11750356_11765031 RANBP9 coding upstream 184889 11749765 ~ 11766104 (+)
CI01000004_12033980_12034384 NA coding downstream 82299 12033656 ~ 12034402 (+)
CI01000004_12222833_12223126 NA coding downstream 270569 12221926 ~ 12223244 (+)
CI01000004_12331486_12332789 NA coding downstream 379483 12330840 ~ 12332997 (+)
CI01000004_12353073_12362622 KLHL18 coding downstream 401603 12352960 ~ 12362716 (+)
CI01000004_12362858_12363136 NA coding downstream 411450 12362807 ~ 12363136 (+)
G31762 NA non-coding upstream 16547 11932387 ~ 11934446 (+)
G31764 NA non-coding upstream 18798 11931359 ~ 11932195 (+)
G31758 NA non-coding upstream 19855 11900321 ~ 11931138 (+)
G31770 NA non-coding upstream 35053 11909083 ~ 11915940 (+)
G31785 NA non-coding upstream 54864 11895853 ~ 11896129 (+)
G31769 NA non-coding downstream 2014 11953371 ~ 11954914 (+)
G31773 NA non-coding downstream 43539 11994896 ~ 12000711 (+)
G31759 NA non-coding downstream 67191 12018548 ~ 12021668 (+)
G31777 NA non-coding downstream 79774 12031131 ~ 12033537 (+)
G31763 NA non-coding downstream 99468 12050825 ~ 12051571 (+)
CI01000004_11666900_11667179 NA other upstream 283334 11666900 ~ 11667659 (+)
G31710 NA other upstream 308593 11637251 ~ 11642400 (+)
G30797 NA other upstream 1453205 10497376 ~ 10497788 (+)
CI01000004_08976512_08980033 TTPA other upstream 2970009 8976254 ~ 8980984 (+)
G28859 NA other upstream 3351390 8599235 ~ 8599603 (+)
G31865 NA other downstream 240773 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 691397 12646838 ~ 12652570 (+)
CI01000004_14036114_14036449 KIAA0040 other downstream 2072190 14035393 ~ 14039142 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other downstream 3139887 15091200 ~ 15097173 (+)
G34220 NA other downstream 3988000 15939357 ~ 15939950 (+)

Expression


Co-expression Network