G34193


Basic Information

Item Value
gene id G34193
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15776790 ~ 15777008 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38756
GGAAGGTCTTTATTAAATCTGAGGGGCTTGTTGTTGTCAATCTCATATTATGAAAAACTGATATGCTGCGCATGTGCAATGTGCTTTTAGGCCCTCCCAACCTCTCATATATTGACACCCTGGTTAACTGGTTGTGTTGTACTATTCCTTCAAAACTATATGCTAAATGACTGAATTTAAAGGGATAGTTCACCCAAAAATGAAAATTATCCCATGATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38756 True 219 lncRNA 0.42 1 15776790 15777008

Neighbor

gene id symbol gene type direction distance location
CI01000004_15711867_15722470 PARP2 coding upstream 54208 15711867 ~ 15722582 (+)
CI01000004_15694735_15698103 SDR39U1 coding upstream 78369 15694735 ~ 15698421 (+)
CI01000004_15687242_15691238 NA coding upstream 85513 15685262 ~ 15691277 (+)
CI01000004_15645965_15650241 NA coding upstream 126516 15645965 ~ 15650274 (+)
CI01000004_15631508_15632389 NA coding upstream 144387 15631430 ~ 15632403 (+)
CI01000004_15787382_15803133 NA coding downstream 10374 15787382 ~ 15803144 (+)
CI01000004_15825817_15827475 TEP1 coding downstream 48809 15825817 ~ 15827603 (+)
CI01000004_15859240_15861471 APOL1 coding downstream 82232 15859240 ~ 15863449 (+)
CI01000004_15867404_15875293 NA coding downstream 89977 15866985 ~ 15875304 (+)
CI01000004_15892502_15900203 DCAF8 coding downstream 113365 15890373 ~ 15900852 (+)
G34192 NA non-coding upstream 277 15776259 ~ 15776513 (+)
G34188 NA non-coding upstream 8799 15767752 ~ 15767991 (+)
G34186 NA non-coding upstream 20399 15756035 ~ 15756391 (+)
G34183 NA non-coding upstream 24242 15751663 ~ 15752548 (+)
G34181 NA non-coding upstream 27864 15748649 ~ 15748926 (+)
G34194 NA non-coding downstream 25 15777033 ~ 15777351 (+)
G34195 NA non-coding downstream 2158 15779166 ~ 15779498 (+)
G34196 NA non-coding downstream 2667 15779675 ~ 15780624 (+)
G34205 NA non-coding downstream 66124 15843132 ~ 15843402 (+)
G34213 NA non-coding downstream 110270 15887278 ~ 15887534 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 684821 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 1739890 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 3121079 12646838 ~ 12652570 (+)
G31865 NA other upstream 3581643 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 4109131 11666900 ~ 11667659 (+)
G34220 NA other downstream 162349 15939357 ~ 15939950 (+)
G33815 NA other downstream 286407 16063415 ~ 16066464 (+)
G34400 NA other downstream 1200320 16971995 ~ 17025976 (+)

Expression


Co-expression Network