G88344


Basic Information

Item Value
gene id G88344
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035906.1
NCBI id CM008309.1
chromosome length 35377769
location 4452634 ~ 4453868 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU118885
gtttcatggctaaattggagcagcctggtggccaatcttcattaattgcacattgcaccagtaagagcagagtgtgaaggttcaattagcagggtaagagcacagttttactcaaaatattgcaatgcacacaacattatgggtgacataccagagttcaaaagaggacaaattgttggggcacgtcttgctggcgcatctgtgaccaagacagcaagtctttgtgatgtatcaagagccacggtatccagggtaatgtcagcataccaccaagaaggaccaaccacatccaacaggattaactgtggacgctgcaagaggaagctgtctgaaagggatgttcgggtgctaacccggattgtatccaaa

Function

GO: NA

KEGG:

id description
ko00040 Pentose and glucuronate interconversions
ko00380 Tryptophan metabolism
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU118885 True 369 lncRNA 0.46 2 4452634 4453868

Neighbor

gene id symbol gene type direction distance location
rreb1 rreb1b coding upstream 297239 4076926 ~ 4155395 (+)
ly86 NA coding upstream 394061 4051732 ~ 4058573 (+)
fars2 fars2,LOC107593111,LOC107692761 coding upstream 502755 3756407 ~ 3949879 (+)
ppp1r3g NA coding upstream 855253 3595795 ~ 3597381 (+)
LOC103035299 cyb5a,LOC103035299,LOC108431496,LOC108272069,LOC107593110,LOC107713729,LOC107653797,LOC107692771 coding upstream 868431 3572497 ~ 3584203 (+)
LOC103038427 snx16,LOC103038427,LOC108431374 coding downstream 301990 4755858 ~ 4777076 (+)
wwp1 wwp1 coding downstream 373576 4827444 ~ 4876837 (+)
cul2 cul2 coding downstream 435406 4889274 ~ 4909032 (+)
nrp1 nrp1,LOC107565689,LOC106578544 coding downstream 1274650 5728518 ~ 5821874 (+)
itgb1 itgb1,itgb1a,LOC107566918,LOC107565694,LOC107653806 coding downstream 1377965 5831833 ~ 5874724 (+)
G88327 NA non-coding upstream 253490 4197327 ~ 4199144 (+)
LOC111193316 NA non-coding upstream 279175 4159550 ~ 4173459 (+)
G88298 NA non-coding upstream 429083 3975729 ~ 4023551 (+)
G88305 NA non-coding upstream 450739 4000427 ~ 4001895 (+)
G88294 NA non-coding upstream 551023 3901026 ~ 3901611 (+)
G88454 NA non-coding downstream 74231 4528099 ~ 4528324 (+)
G88459 NA non-coding downstream 119343 4573211 ~ 4573628 (+)
G88475 NA non-coding downstream 422432 4876300 ~ 4909040 (+)
LOC111193318 NA non-coding downstream 585987 5039855 ~ 5041010 (+)
G88532 NA non-coding downstream 839750 5293618 ~ 5296539 (+)
G88473 NA other downstream 226245 4680113 ~ 4680837 (+)
G88486 NA other downstream 342954 4796822 ~ 4806673 (+)
pard3 LOC108431315 other downstream 457788 4911656 ~ 5463025 (+)
trnap-agg_3 NA other downstream 2789038 7242906 ~ 7242977 (+)
G88849 NA other downstream 3124742 7578610 ~ 7579960 (+)

Expression


Co-expression Network