G46248


Basic Information

Item Value
gene id G46248
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 9091251 ~ 9091459 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU52596
AAGCAGTGTTTTGAAATCGCCCATCACTAGATATTGTTGAATAAAGTCGTCTATTTTGTTTTTTTGGCGCACAAAAAGTATTCTTGTCGCGTCATAACATTAAGGTTGAACCACTGTAGTCACATGAACTATTTTAAATATGTCTTTAGTACCTTTCTCGGTATTTGAAAGTGTTAATGATCTTGCTGGCAATGCAGGCCTCACTGAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU52596 True 209 lncRNA 0.36 1 9091251 9091459

Neighbor

gene id symbol gene type direction distance location
CI01000006_09066050_09070383 BARH1, BARHL1B, BARHL1 coding upstream 20670 9065962 ~ 9070581 (+)
CI01000006_09004949_09014310 GSNA, GSN coding upstream 76662 9004674 ~ 9014589 (+)
CI01000006_08847431_08853895 NA coding upstream 237330 8846260 ~ 8853921 (+)
CI01000006_08757702_08765273 WDR5, WDR5B, WDR5.L, BRAFLDRAFT_281422 coding upstream 325189 8757419 ~ 8766062 (+)
CI01000006_08673737_08674685 NA coding upstream 416137 8673580 ~ 8675114 (+)
CI01000006_09098943_09103197 NA coding downstream 7223 9098682 ~ 9104172 (+)
CI01000006_09105004_09106470 NA coding downstream 12756 9104215 ~ 9106963 (+)
CI01000006_09107491_09114820 GTF3C4 coding downstream 15367 9106826 ~ 9115071 (+)
CI01000006_09192219_09195918 NA coding downstream 100438 9191897 ~ 9195984 (+)
CI01000006_09320331_09321778 UB2G1, UBE2G1A, UBE2G1, UBE2G1B coding downstream 228872 9320331 ~ 9321778 (+)
G46246 NA non-coding upstream 1019 9090026 ~ 9090232 (+)
G45796 NA non-coding upstream 12589 9078441 ~ 9078662 (+)
G45787 NA non-coding upstream 36955 9053984 ~ 9054296 (+)
G45778 NA non-coding upstream 50083 9040967 ~ 9041168 (+)
G45769 NA non-coding upstream 53681 9030360 ~ 9037570 (+)
G46256 NA non-coding downstream 3744 9095203 ~ 9095595 (+)
G46267 NA non-coding downstream 10576 9102035 ~ 9102456 (+)
G46284 NA non-coding downstream 49971 9141430 ~ 9141660 (+)
G46288 NA non-coding downstream 56212 9147671 ~ 9147892 (+)
G46296 NA non-coding downstream 67118 9158577 ~ 9158906 (+)
G45416 NA other upstream 256554 8818814 ~ 8834697 (+)
G45355 NA other upstream 878863 8209555 ~ 8212388 (+)
CI01000006_08198328_08199463 NA other upstream 891106 8197881 ~ 8200145 (+)
G45336 NA other upstream 1069300 8019342 ~ 8021951 (+)
G45265 NA other upstream 1170896 7883867 ~ 7920355 (+)
G46652 NA other downstream 1065120 10156579 ~ 10159251 (+)
G47145 NA other downstream 1393899 10485358 ~ 10511806 (+)
G47159 NA other downstream 2324770 11416229 ~ 11521703 (+)
G47318 NA other downstream 2532808 11624267 ~ 11638252 (+)
G48094 NA other downstream 3186161 12277620 ~ 12279541 (+)

Expression


Co-expression Network