G46662


Basic Information

Item Value
gene id G46662
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 9986914 ~ 9987133 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU53056
GTTAGTTCCAAATAACCAAAATAAGCTTTCTTCGTTCACAGATGATGATTTTTGGTGTGATATTAGGCCTATAAAAGGATCAATAGATTAATTGAAGTTGTCAGATCAGCTCCCTCTTTATGTCATGAATTTGCCATTTAAAGGGAAGTGCCAGTGGGGGGTTGGCATTAACCAGACACCTAAAGGGCACGCCATTAATCACTATCCTATGTAGGTGGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU53056 True 220 lncRNA 0.48 1 9986914 9987133

Neighbor

gene id symbol gene type direction distance location
CI01000006_09918611_09921465 MZT2B coding upstream 65121 9918611 ~ 9921793 (+)
CI01000006_09910027_09913958 NA coding upstream 72810 9909370 ~ 9914104 (+)
CI01000006_09891107_09897750 NA coding upstream 89151 9891107 ~ 9897763 (+)
CI01000006_09884959_09889794 NA coding upstream 96625 9884439 ~ 9890289 (+)
CI01000006_09836923_09844045 NA coding upstream 142566 9836923 ~ 9846207 (+)
CI01000006_09998680_10008491 LHX5 coding downstream 11547 9998680 ~ 10009048 (+)
CI01000006_10177090_10192651 NA coding downstream 189957 10177090 ~ 10193519 (+)
CI01000006_10363884_10364804 NA coding downstream 376663 10363796 ~ 10365571 (+)
CI01000006_10518326_10566504 SFSWAP coding downstream 531193 10518326 ~ 10566504 (+)
CI01000006_10574971_10578629 NA coding downstream 587475 10574608 ~ 10578964 (+)
G46569 NA non-coding upstream 129819 9856747 ~ 9857095 (+)
G46566 NA non-coding upstream 135080 9851629 ~ 9851834 (+)
G46565 NA non-coding upstream 135456 9851135 ~ 9851458 (+)
G46526 NA non-coding upstream 157340 9819361 ~ 9829574 (+)
G46665 NA non-coding downstream 1848 9988981 ~ 9989253 (+)
G46671 NA non-coding downstream 6610 9993743 ~ 9994022 (+)
G46677 NA non-coding downstream 25757 10012890 ~ 10013116 (+)
G46680 NA non-coding downstream 29217 10016350 ~ 10017401 (+)
G46681 NA non-coding downstream 30291 10017424 ~ 10018083 (+)
G45416 NA other upstream 1152217 8818814 ~ 8834697 (+)
G45355 NA other upstream 1774526 8209555 ~ 8212388 (+)
CI01000006_08198328_08199463 NA other upstream 1786769 8197881 ~ 8200145 (+)
G45336 NA other upstream 1964963 8019342 ~ 8021951 (+)
G45265 NA other upstream 2066559 7883867 ~ 7920355 (+)
G46652 NA other downstream 169446 10156579 ~ 10159251 (+)
G47145 NA other downstream 498225 10485358 ~ 10511806 (+)
G47159 NA other downstream 1429096 11416229 ~ 11521703 (+)
G47318 NA other downstream 1637134 11624267 ~ 11638252 (+)
G48094 NA other downstream 2290487 12277620 ~ 12279541 (+)

Expression


Co-expression Network