G9934 (tbc1d16)


Basic Information

Item Value
gene id G9934
gene name tbc1d16
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035898.1
NCBI id CM008301.1
chromosome length 34292151
location 12338532 ~ 12339611 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU13457
AGCTTGTACTCCTCCTCCACCTGGCCGCTGTGGTTGAGGTGCCGGAGCCAGGAGCTGACGTCCAGCCTGCGGTACAGCCGCTCCTCCGGGTGGGTCTCGGTCGAGGGCAGGGTGGGTCTGCGTATAGAGAACTGCATGCAGGACTTCTCATCCGCCACCTGAGACAAACAAACCTGGTCTTTGAGCTGCGTCTCTCTGCAGCATTTCCACTGCTGGAAGACTTCAGCCAGCTTGTCCAGGCCGGCGTGGTGGAAGTGCAGGATCTTATACTGACTCTCTCTGCTGGCGATGACCAGCTGACCACAGGTACACGCCTCATC

Function

symbol description
tbc1d16 Predicted to enable GTPase activator activity. Predicted to be involved in activation of GTPase activity and intracellular protein transport. Predicted to be active in early endosome. Orthologous to human TBC1D16 (TBC1 domain family member 16).

NR:

description
PREDICTED: TBC1 domain family member 16

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU13457 True 320 lncRNA 0.60 2 12338532 12339611

Neighbor

gene id symbol gene type direction distance location
LOC103032330 tnpo2,LOC108432206,LOC103360699 coding downstream 55357 12251498 ~ 12283175 (-)
tmem104 tmem104,LOC102781590 coding downstream 93723 12154438 ~ 12244809 (-)
LOC103046502 LOC108432211 coding downstream 459206 11875121 ~ 11879326 (-)
LOC103046814 NA coding downstream 465174 11842435 ~ 11873358 (-)
smarca4 smarca4,LOC108278850 coding downstream 496465 11816583 ~ 11842067 (-)
LOC111194168 NA coding upstream 152273 12491884 ~ 12497836 (-)
LOC103031371 LOC103031371,LOC108432163,LOC108275528 coding upstream 162987 12502598 ~ 12516580 (-)
slc5a11 slc5a11,LOC107670676 coding upstream 263283 12602894 ~ 12619200 (-)
grid2ip grid2ipa,LOC108432200,LOC108279372,LOC107758114,LOC107670677,LOC107583579 coding upstream 282269 12621880 ~ 12655333 (-)
LOC103033800 ppfia3,LOC108415507,LOC107687647,LOC107551161,LOC107563979,LOC107729434 coding upstream 334598 12674209 ~ 12715714 (-)
G9933 NA non-coding downstream 10097 12328092 ~ 12328435 (-)
G9931 NA non-coding downstream 18015 12320300 ~ 12320517 (-)
G9911 NA non-coding downstream 36832 12298676 ~ 12301700 (-)
LOC107197310 NA non-coding downstream 88318 12245862 ~ 12250214 (-)
G9891 NA non-coding downstream 221189 12117016 ~ 12117343 (-)
G9937 NA non-coding upstream 6905 12346516 ~ 12406173 (-)
G9939 NA non-coding upstream 36572 12376183 ~ 12381296 (-)
G10015 LOC108432202 non-coding upstream 205583 12545194 ~ 12572345 (-)
G10013 NA non-coding upstream 256060 12595671 ~ 12599576 (-)
G10036 NA non-coding upstream 326261 12665872 ~ 12666888 (-)
LOC103022087 foxd1,LOC103022087,LOC106569011,LOC108432165 other downstream 660424 11676154 ~ 11678108 (-)
G9632 atp5h,LOC103042933,LOC103361245,LOC107670447 other downstream 994270 11340140 ~ 11344262 (-)
G9469 NA other downstream 1943052 10393462 ~ 10395480 (-)
LOC111194270 NA other downstream 2113042 10221156 ~ 10225490 (-)
G9350 rai1 other downstream 2628131 9709792 ~ 9710401 (-)
G10089 akt1s1,LOC107564011,LOC107680841 other upstream 473414 12813025 ~ 12817186 (-)
LOC103034410 lrrc4b,lrrc4ba,LOC103034410,LOC107680881,LOC107551155,LOC107667844,LOC107563987,LOC107732840 other upstream 809746 13149357 ~ 13292878 (-)
LOC103034594 ppp1caa,LOC103034594,LOC105897688,LOC108280818,LOC103367324,LOC101477563,LOC105894037 other upstream 1699247 14038858 ~ 14083107 (-)
G10560 NA other upstream 1901450 14241061 ~ 14243794 (-)
hsd3b7 hsd3b7,LOC106601563 other upstream 2279765 14619376 ~ 14656561 (-)

Expression


Co-expression Network