G180943



Basic Information


Item Value
gene id G180943
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 34106499 ~ 34107595 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU245061
gtttgattttagggttgattaagggttaaggttaggtgtagggtttgattttagggttgattaagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggtaaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggttatattttatggttgattaagggttaagttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttaggtgtagggttatattttatggttgattaagggttaaggttagggttaggtgtagggtttgatttt

Function


GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA


RNA id representative length rna type GC content exon number start site end site
TU245061 True 375 lncRNA 0.37 4 34106499 34107595

Neighbor


gene id symbol gene type direction distance location
mis18a NA coding upstream 138848 33960956 ~ 33967651 (+)
c20h21orf59 c10h21orf59,cunh21orf59,LOC103033817,LOC107691672,LOC105907446 coding upstream 187758 33911224 ~ 33918741 (+)
synj1 NA coding upstream 200508 33858676 ~ 33905991 (+)
LOC107197579 trim47,LOC108423837,LOC107701143,LOC107718738,LOC107557227,LOC107720633 coding upstream 809304 33286435 ~ 33297195 (+)
LOC103028331 frem2,frem2a,LOC107720635,LOC107701139,LOC108276566,LOC107555183 coding upstream 830813 33109991 ~ 33275686 (+)
LOC103024324 kl coding downstream 405643 34513238 ~ 34530693 (+)
stard13 stard13,LOC108415386 coding downstream 438168 34545763 ~ 34726721 (+)
nbea nbeaa,nbea,LOC107691681 coding downstream 668119 34775714 ~ 35070323 (+)
sertm1 sertm1 coding downstream 1115093 35222688 ~ 35232948 (+)
rfxap rfxap coding downstream 1126245 35233840 ~ 35239425 (+)
G180937 NA non-coding upstream 63084 34042618 ~ 34043415 (+)
G180931 NA non-coding upstream 99685 34005963 ~ 34006814 (+)
G180921 NA non-coding upstream 133354 33972944 ~ 33973145 (+)
G180913 NA non-coding upstream 157561 33945665 ~ 33948938 (+)
G180912 NA non-coding upstream 160913 33941889 ~ 33945586 (+)
G181027 NA non-coding downstream 142412 34250007 ~ 34250467 (+)
G181033 NA non-coding downstream 159630 34267225 ~ 34268813 (+)
G181034 NA non-coding downstream 164294 34271889 ~ 34322693 (+)
G181036 NA non-coding downstream 202530 34310125 ~ 34391769 (+)
G181045 NA non-coding downstream 243289 34350884 ~ 34352042 (+)
ufm1 ufm1,LOC107701138 other upstream 1038567 33050242 ~ 33067932 (+)
G180460 cct8,LOC100304907,LOC107693911,LOC107701129 other upstream 1832701 32264998 ~ 32273798 (+)
G180266 NA other upstream 2672590 31433198 ~ 31433909 (+)
G180235 erg other upstream 2955404 31139344 ~ 31151095 (+)
LOC103038954 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other upstream 6581058 27524302 ~ 27525441 (+)
LOC103026201 LOC108277347,LOC108423746,LOC106604019 other downstream 65329 34172924 ~ 34328970 (+)
LOC103024954 LOC108423745 other downstream 226981 34334576 ~ 34507324 (+)
nsun5 nsun5,LOC102793237,LOC107686168 other downstream 1284926 35392521 ~ 35403624 (+)
LOC107197592 NA other downstream 1492888 35600483 ~ 35607593 (+)
LOC103044041 NA other downstream 1577409 35685004 ~ 35702995 (+)

Expression



Co-expression Network