G75976



Basic Information


Item Value
gene id G75976
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 11175300 ~ 11175507 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU86679
AAAGGTTGCTGCAGAAAATGTATTTGAAATGCTGAAGGTGTGTTCAAATCAAATCAGCCAGTTCTGTTTTTGTCTCTTATGCTCACCATGGGTGCATTTATTTGATCAAAAACAGTAAAAATAGTAATACTGTGAAATATTATTTCAATTTAAAATAACTGTTTTCTACTTCAATATATTTTAAAGTATAATTTATTCCTGTGATCCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU86679 True 208 lncRNA 0.29 1 11175300 11175507

Neighbor


gene id symbol gene type direction distance location
CI01000012_11088423_11089301 NA coding downstream 85108 11088141 ~ 11090192 (-)
CI01000012_11068977_11070913 NA coding downstream 103971 11068861 ~ 11071329 (-)
CI01000012_11047566_11050458 NA coding downstream 122888 11047388 ~ 11052412 (-)
CI01000012_11000305_11008211 SLC24A3 coding downstream 165463 10999678 ~ 11009837 (-)
CI01000012_10993043_10996095 NA coding downstream 179205 10992471 ~ 10996095 (-)
CI01000012_11292683_11315522 NA coding upstream 117176 11292683 ~ 11316018 (-)
CI01000012_11585774_11608639 NA coding upstream 410121 11585628 ~ 11608975 (-)
CI01000012_11799629_11846842 BCL11A coding upstream 624122 11799629 ~ 11846842 (-)
CI01000012_11905259_11905909 NA coding upstream 729649 11905156 ~ 11906244 (-)
CI01000012_11925364_11925971 PHS, PCBD1 coding upstream 749492 11924999 ~ 11925971 (-)
G75973 NA non-coding downstream 1429 11173577 ~ 11173871 (-)
G75969 NA non-coding downstream 12722 11162244 ~ 11162578 (-)
G75961 NA non-coding downstream 19808 11154688 ~ 11155492 (-)
G75958 NA non-coding downstream 22342 11152621 ~ 11152958 (-)
G75956 NA non-coding downstream 24111 11150862 ~ 11151189 (-)
G75995 NA non-coding upstream 21800 11197307 ~ 11197733 (-)
G76001 NA non-coding upstream 30447 11205954 ~ 11206153 (-)
G76012 NA non-coding upstream 58319 11233826 ~ 11236699 (-)
G76683 NA non-coding upstream 85809 11261316 ~ 11261582 (-)
G76896 NA non-coding upstream 533359 11708866 ~ 11709233 (-)
G75608 NA other downstream 554429 10611915 ~ 10620871 (-)
G74982 NA other downstream 1599328 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 1773332 9398076 ~ 9402378 (-)
CI01000012_09082056_09083285 NA other downstream 2091811 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 2101843 9071371 ~ 9073457 (-)
CI01000012_12047175_12052116 NA other upstream 873537 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 903429 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 1778939 12954446 ~ 12957833 (-)
G77287 NA other upstream 2443769 13619276 ~ 13633819 (-)

Expression



Co-expression Network