G76001


Basic Information

Item Value
gene id G76001
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 11205954 ~ 11206153 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU86704
TCTCGTATCTCTCACGGAGGAGCTCCGGAAGCATAAAAGGAGGAGCAATGACAATGAAGGACGAGAGAGGACCAGGCCTGGATTTATTTTATGGTTTTATTATGTTTGTGTGGCCGGTAGACGTCCGTGAGGGTCTGCCGGCATTTTACTTTCGTTTTGTTGTTTGTTTATTTTAAATATTATTAAAGTTGTGTTTAACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU86704 True 200 lncRNA 0.41 1 11205954 11206153

Neighbor

gene id symbol gene type direction distance location
CI01000012_11088423_11089301 NA coding downstream 115762 11088141 ~ 11090192 (-)
CI01000012_11068977_11070913 NA coding downstream 134625 11068861 ~ 11071329 (-)
CI01000012_11047566_11050458 NA coding downstream 153542 11047388 ~ 11052412 (-)
CI01000012_11000305_11008211 SLC24A3 coding downstream 196117 10999678 ~ 11009837 (-)
CI01000012_10993043_10996095 NA coding downstream 209859 10992471 ~ 10996095 (-)
CI01000012_11292683_11315522 NA coding upstream 86530 11292683 ~ 11316018 (-)
CI01000012_11585774_11608639 NA coding upstream 379475 11585628 ~ 11608975 (-)
CI01000012_11799629_11846842 BCL11A coding upstream 593476 11799629 ~ 11846842 (-)
CI01000012_11905259_11905909 NA coding upstream 699003 11905156 ~ 11906244 (-)
CI01000012_11925364_11925971 PHS, PCBD1 coding upstream 718846 11924999 ~ 11925971 (-)
G75995 NA non-coding downstream 8221 11197307 ~ 11197733 (-)
G75976 NA non-coding downstream 30447 11175300 ~ 11175507 (-)
G75973 NA non-coding downstream 32083 11173577 ~ 11173871 (-)
G75969 NA non-coding downstream 43376 11162244 ~ 11162578 (-)
G75961 NA non-coding downstream 50462 11154688 ~ 11155492 (-)
G76012 NA non-coding upstream 27673 11233826 ~ 11236699 (-)
G76683 NA non-coding upstream 55163 11261316 ~ 11261582 (-)
G76896 NA non-coding upstream 502713 11708866 ~ 11709233 (-)
G76899 NA non-coding upstream 509667 11715820 ~ 11716036 (-)
G76900 NA non-coding upstream 509892 11716045 ~ 11716250 (-)
G75608 NA other downstream 585083 10611915 ~ 10620871 (-)
G74982 NA other downstream 1629982 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 1803986 9398076 ~ 9402378 (-)
CI01000012_09082056_09083285 NA other downstream 2122465 9081877 ~ 9083489 (-)
CI01000012_09071892_09073410 NA other downstream 2132497 9071371 ~ 9073457 (-)
CI01000012_12047175_12052116 NA other upstream 842891 12046728 ~ 12052541 (-)
CI01000012_12079581_12084139 NA other upstream 872783 12078936 ~ 12084260 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 1748293 12954446 ~ 12957833 (-)
G77287 NA other upstream 2413123 13619276 ~ 13633819 (-)

Expression


Co-expression Network