G80409



Basic Information


Item Value
gene id G80409
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 3962977 ~ 3963204 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU91542
TAAAAATCAATCAAAAGTGACAGTAAAGACATTTATGTAACAAGATTTCCATATTAAATAAAATGCTGTTCTTTTAAGTGTTCTATTTACCCAAAAATTACATTTCTGTCAATAATTACTCACCTTCATGTCTTTCCAACCTCTTAAGACCTTCGTTCATCTTTGGAACACAAATTAAGGTTTTTTTTGTTTTGTTTTGTTTTGTTTTTTTAAATCTCCCACAGAAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU91542 True 228 lncRNA 0.28 1 3962977 3963204

Neighbor


gene id symbol gene type direction distance location
CI01000013_03938659_03945995 DDB2 coding downstream 16678 3938503 ~ 3946299 (-)
CI01000013_03929711_03933888 KBTBD4 coding downstream 28859 3928833 ~ 3934118 (-)
CI01000013_03918402_03926395 RAPSN coding downstream 36582 3918172 ~ 3926395 (-)
CI01000013_03911586_03916513 NA coding downstream 46343 3910609 ~ 3916634 (-)
CI01000013_03897674_03902314 AGK coding downstream 60663 3896594 ~ 3902314 (-)
CI01000013_04069517_04083528 TLE3, TLE3A coding upstream 105841 4069045 ~ 4083746 (-)
CI01000013_04091772_04094858 NA coding upstream 127301 4090505 ~ 4094858 (-)
CI01000013_04117349_04119235 NA coding upstream 153058 4116262 ~ 4120153 (-)
CI01000013_04186280_04202524 NA coding upstream 222332 4185536 ~ 4202524 (-)
CI01000013_04206025_04212137 MORF4L1B, MORF4L1 coding upstream 242517 4205721 ~ 4212137 (-)
G80408 NA non-coding downstream 129 3962522 ~ 3962848 (-)
G80407 NA non-coding downstream 598 3962138 ~ 3962379 (-)
G80404 NA non-coding downstream 1400 3959843 ~ 3961577 (-)
G80402 NA non-coding downstream 14157 3946851 ~ 3948820 (-)
G80382 NA non-coding downstream 122843 3837914 ~ 3840134 (-)
G80440 NA non-coding upstream 50866 4014070 ~ 4014305 (-)
G80452 NA non-coding upstream 60930 4024134 ~ 4024497 (-)
G80477 NA non-coding upstream 135540 4098744 ~ 4098963 (-)
G80491 NA non-coding upstream 151074 4114278 ~ 4114512 (-)
G80639 NA non-coding upstream 172029 4135233 ~ 4135483 (-)
G80399 NA other downstream 56737 3904067 ~ 3906240 (-)
G80271 NA other downstream 239370 3719433 ~ 3723607 (-)
G80262 NA other downstream 395440 3565171 ~ 3567537 (-)
G79690 NA other downstream 1147585 2813247 ~ 2815392 (-)
G78296 NA other downstream 3936080 26528 ~ 26897 (-)
G80443 NA other upstream 101738 4064942 ~ 4066017 (-)
CI01000013_04561253_04567647 MAP2K1 other upstream 593664 4560340 ~ 4567647 (-)
G81032 NA other upstream 785605 4748809 ~ 4750561 (-)
G81547 NA other upstream 1776322 5739526 ~ 5744038 (-)
CI01000013_05883498_05884071 CHTF8 other upstream 1918845 5882049 ~ 5884071 (-)

Expression



Co-expression Network