G81994


Basic Information

Item Value
gene id G81994
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 7335945 ~ 7338239 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU93312
TCAGGACTCTGTGTTTAGCCAACAGCTGATTTTTTAGAAAGCAAAGAGCTGGGAGGATACACAATTTTAAGAAGAATTAACATCTTTTGCAGTTGTACGCATCTAGTTATTTAACTAAATATGGCAGAGACAGACCCGAAATCGGTGCAGGATCTCACAGCAGTGGTGCAGACATTGCTGCAGCAGATGCAGGATAAATTCCAGACAATGTCAGACCAGATCATCGGGAGAATTGATGAAATGAGCACCCGCATCGATGATCTAGAGAAGAACATAGCAGATCTGATGACTCAGGCTGGAGTGGAAGAGATTGAAGGGGAGAACAAGGTCAAAGAGGGAGGAGAGGCCTCCTAGTAGAGGATGCTGAGTAGAAGACACTATATAAACCATTCAGGAGCAGCAAAATTTTCTCTATGGTGACTAACATGTTTCAATTTGATGTGATGCTTTTTTTTTAATATTTAGCAGGAATTAAAGTCAATCTTGATGCTGTGACTGTATGCTACCCTTTTTTTTCCTTTTTGCTGTAATGGACTGCAAAGAACTTTTTAAACATGACATCCAACTGTAGAATCGAACCCCGCGTTACTGTAATAACAGCACTAGCCCAAGTGCCAACCTAACAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU93312 True 626 TUCP 0.41 4 7335945 7338239

Neighbor

gene id symbol gene type direction distance location
CI01000013_07286519_07288160 NA coding upstream 47398 7286442 ~ 7288547 (+)
CI01000013_07277014_07279249 NA coding upstream 56626 7276610 ~ 7279319 (+)
CI01000013_07154745_07159568 PECR coding upstream 176337 7154745 ~ 7159608 (+)
CI01000013_07148102_07150807 PDF coding upstream 184990 7148052 ~ 7150955 (+)
CI01000013_07131096_07141914 NA coding upstream 193903 7130952 ~ 7142042 (+)
CI01000013_07375912_07390782 MLYCD coding downstream 35579 7373818 ~ 7391003 (+)
CI01000013_07765924_07780475 NA coding downstream 426446 7764685 ~ 7780716 (+)
CI01000013_07791141_07802608 NA coding downstream 452465 7790704 ~ 7802710 (+)
CI01000013_07929832_07935997 GAN coding downstream 591593 7929832 ~ 7935997 (+)
CI01000013_07970614_07989626 CMIP coding downstream 632375 7970614 ~ 7989756 (+)
G82017 NA non-coding upstream 60058 7275677 ~ 7275887 (+)
G82013 NA non-coding upstream 66109 7269617 ~ 7269836 (+)
G82010 NA non-coding upstream 68629 7267094 ~ 7267316 (+)
G81985 NA non-coding upstream 142959 7190949 ~ 7192986 (+)
G81939 NA non-coding upstream 250444 6987893 ~ 7085501 (+)
G82045 NA non-coding downstream 1490 7339729 ~ 7340751 (+)
G82050 NA non-coding downstream 10480 7348719 ~ 7352640 (+)
G82061 NA non-coding downstream 70730 7408969 ~ 7409238 (+)
G82065 NA non-coding downstream 89578 7427817 ~ 7428019 (+)
G82069 NA non-coding downstream 103548 7441787 ~ 7442004 (+)
CI01000013_06076169_06080164 NA other upstream 1253578 6075400 ~ 6081684 (+)
CI01000013_06050285_06059640 NA other upstream 1276449 6049864 ~ 6060269 (+)
G80845 NA other upstream 2499713 4835078 ~ 4836232 (+)
CI01000013_04051081_04064651 NA other upstream 3270116 4050837 ~ 4065829 (+)
G80062 NA other upstream 3751161 3584008 ~ 3584784 (+)
G82168 NA other downstream 690099 8028338 ~ 8041343 (+)
G82581 NA other downstream 1991090 9329329 ~ 9334948 (+)
G84005 NA other downstream 2263372 9601611 ~ 9602235 (+)
G84194 NA other downstream 2692369 10030608 ~ 10036953 (+)
G84215 NA other downstream 2738215 10076454 ~ 10079336 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location