G95893


Basic Information

Item Value
gene id G95893
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 5500828 ~ 5501124 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU109060
AAAAAAAAATGCATCCATCCATAATCAAAGTAATCCATACGGCTCCAGTGGGTTAATAAAGGCCTTTTGAAGTGAAGCGATGGGTTTTTGTAATAAAAATATCTATATTTGAAACTTCAAATAACTAGCTTCCGGTGGACGACCGCATATGCATACTGCGTAACTCGACTAAATGAGTAATCCTCTGACGCGATGTATGACGCAGGATGTAGGAGAACTGTAAGCTTAGACGCCTCTCATGGTTCAAACAAATAGGGCTGTGCAACAAACTCAAGCTCCTCTTCACTTGTATCCGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU109060 True 297 lncRNA 0.41 1 5500828 5501124

Neighbor

gene id symbol gene type direction distance location
CI01000016_05475350_05482964 U2AF2, U2AF2A, U2AF2B coding upstream 16882 5475350 ~ 5483946 (+)
CI01000016_05445824_05454816 EPN1 coding upstream 45412 5445824 ~ 5455416 (+)
CI01000016_05405791_05407797 AICDA coding upstream 92865 5405791 ~ 5407963 (+)
CI01000016_05398036_05400369 NAT14 coding upstream 100422 5398036 ~ 5400406 (+)
CI01000016_05388832_05396460 ZNF628 coding upstream 103748 5388832 ~ 5397080 (+)
CI01000016_05698858_05706081 NA coding downstream 197734 5698858 ~ 5706719 (+)
CI01000016_05797506_05798075 NA coding downstream 296382 5797506 ~ 5799585 (+)
CI01000016_05828974_05833309 JOSD2, JOS2 coding downstream 327274 5828398 ~ 5833377 (+)
CI01000016_05837368_05837667 NA coding downstream 335459 5836583 ~ 5837927 (+)
CI01000016_05878037_05885761 FLCN coding downstream 376913 5878037 ~ 5886192 (+)
G95892 NA non-coding upstream 34 5500417 ~ 5500794 (+)
G95891 NA non-coding upstream 686 5499790 ~ 5500142 (+)
G95890 NA non-coding upstream 1173 5499358 ~ 5499655 (+)
G95889 NA non-coding upstream 1871 5498268 ~ 5498957 (+)
G95888 NA non-coding upstream 3986 5496643 ~ 5496842 (+)
G95894 NA non-coding downstream 7 5501131 ~ 5501351 (+)
G95811 NA non-coding downstream 18014 5519138 ~ 5528039 (+)
G95896 NA non-coding downstream 44615 5545739 ~ 5545986 (+)
G95897 NA non-coding downstream 45022 5546146 ~ 5546391 (+)
G95898 NA non-coding downstream 62191 5563315 ~ 5563610 (+)
G95792 NA other upstream 274887 5219880 ~ 5225941 (+)
CI01000016_04829592_04837305 NA other upstream 664173 4829592 ~ 4837457 (+)
G95648 NA other upstream 1226923 4272636 ~ 4273905 (+)
G95439 NA other upstream 1636971 3862175 ~ 3862305 (+)
G96389 NA other downstream 1659517 7160641 ~ 7161290 (+)
CI01000016_07784248_07784757 TWIST1, TWIST1.L, TWIST1A, TWIST1B, TWST2, TWIST1.S other downstream 2282941 7783987 ~ 7784996 (+)
G97824 NA other downstream 2513239 8014363 ~ 8015775 (+)
G98288 NA other downstream 3494974 8996098 ~ 9002717 (+)
CI01000016_09796196_09842235 NA other downstream 4294507 9795950 ~ 9842576 (+)

Expression


Co-expression Network