G97310


Basic Information

Item Value
gene id G97310
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 6094880 ~ 6095235 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU110755
AAAGAATTGAAAGTGGGGGGGAAAATCACATTATGAAATAAATGTTTTTCTCCAAAACACATTGGCCACAATTATTGGCACCCTTTTATTCAATACTTTTTGCAACCTCCGTTTGCAAAGATAACAGCTCTGAGTCTTCACCTATAATGCCTGATGAGTTTGGAGAACACCTGACAAGAGATCAGAGACCATTCCTTCATACAGGATCTCTACAGATCCTTCAGATTCCCAGCTCCATGTTGGTGCTTCTTTTCTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU110755 True 257 lncRNA 0.40 2 6094880 6095235

Neighbor

gene id symbol gene type direction distance location
CI01000016_06048748_06054049 RNF115 coding downstream 40831 6048740 ~ 6054049 (-)
CI01000016_06018338_06023791 NA coding downstream 71089 6018330 ~ 6023791 (-)
CI01000016_05986400_05994821 TRIM109 coding downstream 100059 5986400 ~ 5994821 (-)
CI01000016_05945614_05946695 NA coding downstream 146571 5945559 ~ 5948309 (-)
CI01000016_05930860_05934507 RCVRN2 coding downstream 160373 5930853 ~ 5934507 (-)
CI01000016_06131958_06135495 NA coding upstream 35543 6130778 ~ 6135495 (-)
CI01000016_06138000_06138287 NA coding upstream 42372 6137607 ~ 6138425 (-)
CI01000016_06146332_06147633 NA coding upstream 50988 6146223 ~ 6147667 (-)
CI01000016_06147867_06148327 NA coding upstream 52473 6147708 ~ 6148348 (-)
CI01000016_06162256_06162804 NA coding upstream 66919 6162154 ~ 6163022 (-)
G97303 NA non-coding downstream 14384 6080274 ~ 6080496 (-)
G97201 NA non-coding downstream 110056 5984069 ~ 5984824 (-)
G97193 NA non-coding downstream 130539 5960341 ~ 5964341 (-)
G97282 NA non-coding downstream 135407 5952958 ~ 5959473 (-)
G97188 NA non-coding downstream 171501 5887681 ~ 5923379 (-)
G97333 NA non-coding upstream 47512 6142747 ~ 6143053 (-)
G97335 NA non-coding upstream 56206 6151441 ~ 6151680 (-)
G97224 NA non-coding upstream 117317 6212552 ~ 6212818 (-)
G97187 NA non-coding upstream 117760 6212995 ~ 6213650 (-)
G97237 NA non-coding upstream 118677 6213912 ~ 6214493 (-)
CI01000016_05412782_05415867 NA other downstream 676663 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 764034 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 1171476 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 2163829 3920055 ~ 3931162 (-)
CI01000016_03647744_03675574 NA other downstream 2429567 3647653 ~ 3675585 (-)
G97341 NA other upstream 63751 6158986 ~ 6159721 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other upstream 2793598 8888833 ~ 8894737 (-)
CI01000016_08926089_08945071 NA other upstream 2841554 8925960 ~ 8945229 (-)
G98679 NA other upstream 3139761 9234996 ~ 9239929 (-)
G98691 NA other upstream 3160867 9256102 ~ 9257611 (-)

Expression


Co-expression Network