G102445


Basic Information

Item Value
gene id G102445
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 239556 ~ 337952 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU116563
CCAGAAAGCTACTAAAAACATATTTAAAACAGTTCATGTTACTACAGTGGTTCAACCTTAATGTTATGAAGCGACGAGAATACTTTTTGTGCACCAAAAAAACAAAATAACGACTTTATTCAACAATATCTAGTGATGGGCGATTTTAAAACACCGCTTCATGAAGTTTCGAAGCGTTACGAATCTTTTGTTTTGAATCAGTGGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU116563 True 206 lncRNA 0.33 2 239556 337952

Neighbor

gene id symbol gene type direction distance location
CI01000018_00207988_00210462 NA coding downstream 27227 207970 ~ 212329 (-)
CI01000018_00071464_00083422 DCAF11 coding downstream 156134 71408 ~ 83422 (-)
CI01000018_00064269_00068791 NA coding downstream 168480 63585 ~ 71076 (-)
CI01000018_00029420_00038887 PCK2 coding downstream 200669 28870 ~ 38887 (-)
CI01000018_00777676_00783256 NA coding upstream 438560 776512 ~ 783529 (-)
CI01000018_00837737_00838788 NA coding upstream 499598 837550 ~ 838864 (-)
CI01000018_00985130_00987510 NA coding upstream 647040 984992 ~ 987689 (-)
CI01000018_00992108_01000450 ZFHX2 coding upstream 653494 991446 ~ 1000450 (-)
CI01000018_01030816_01076302 JPH1A coding upstream 691885 1029837 ~ 1076302 (-)
G102403 NA non-coding downstream 73891 165223 ~ 165665 (-)
G102402 NA non-coding downstream 74848 163795 ~ 164708 (-)
G102344 NA non-coding downstream 188413 50766 ~ 51143 (-)
G102491 NA non-coding upstream 183 338135 ~ 338625 (-)
G102495 NA non-coding upstream 124959 462911 ~ 463149 (-)
G102498 NA non-coding upstream 138122 476074 ~ 476388 (-)
G102503 NA non-coding upstream 156837 494789 ~ 495146 (-)
G102528 NA non-coding upstream 220988 558940 ~ 559318 (-)
G103842 NA other upstream 1621545 1959497 ~ 1960058 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other upstream 2048256 2389201 ~ 2488018 (-)
G104968 NA other upstream 3144152 3482104 ~ 3500514 (-)
G105104 NA other upstream 3669745 4007697 ~ 4017817 (-)
G105200 NA other upstream 3905515 4243467 ~ 4246010 (-)

Expression


Co-expression Network