CI01000019_01235890_01236084 (PIMR70)


Basic Information

Item Value
gene id CI01000019_01235890_01236084
gene name PIMR70
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 1235857 ~ 1236084 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000019_01235890_01236084.mRNA
CACCATGGAGGCATCCTCAGTGAGGACCTAGCACGACTTATCATGTGGCAGGTAGTGCAGGCCGCCCACATGTGCTGTCGCCATGGAGTGCTTCACCGGGATATCAAACTAGAGAACCTGCTGGTCAACAAGGACACGCTTGAAGTCAAACTTATTGACTTCGGGTGCGGGGACCTCCTAAAAACTTCTGCCTAGAAGACATTCTGGGGTATGTATGTATGAATTAAA

Function

symbol description
pimr70 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000019_01235890_01236084.mRNA True 228 mRNA 0.50 1 1235857 1236084

Neighbor

gene id symbol gene type direction distance location
CI01000019_01213457_01219101 NA coding downstream 16521 1212885 ~ 1219336 (-)
CI01000019_01193076_01209887 SCYL2 coding downstream 25970 1192538 ~ 1209887 (-)
CI01000019_01148054_01149463 NA coding downstream 85980 1146108 ~ 1149877 (-)
CI01000019_01085786_01091282 TNNI1C, TNNI1D, TNNI1 coding downstream 144575 1084327 ~ 1091282 (-)
CI01000019_00883109_00944808 IQSEC3, IQSEC3A coding downstream 291049 883070 ~ 944808 (-)
CI01000019_01238694_01247650 METAP2A, METAP2 coding upstream 2562 1238646 ~ 1247650 (-)
CI01000019_01253674_01268268 VETZ, VEZT coding upstream 16580 1252664 ~ 1268268 (-)
CI01000019_01367542_01396290 LAMB1B coding upstream 131440 1367524 ~ 1396290 (-)
CI01000019_01397591_01406229 NA coding upstream 161383 1397467 ~ 1406422 (-)
CI01000019_01444034_01465802 NA coding upstream 207737 1443821 ~ 1466431 (-)
G107728 NA non-coding downstream 66017 1169636 ~ 1169840 (-)
G107725 NA non-coding downstream 71476 1164018 ~ 1164381 (-)
G107721 NA non-coding downstream 77716 1157854 ~ 1158141 (-)
G107712 NA non-coding downstream 92497 1143150 ~ 1143360 (-)
G107709 NA non-coding downstream 102741 1132828 ~ 1133116 (-)
G107738 NA non-coding upstream 84238 1320322 ~ 1322969 (-)
G107766 NA non-coding upstream 110736 1346820 ~ 1349136 (-)
G107743 NA non-coding upstream 125931 1362015 ~ 1363916 (-)
G107768 NA non-coding upstream 158416 1394500 ~ 1394792 (-)
G107778 NA non-coding upstream 186238 1422322 ~ 1422554 (-)
G107779 NA other upstream 187481 1423565 ~ 1423817 (-)
G107820 NA other upstream 242767 1478851 ~ 1479141 (-)
CI01000019_01503557_01515831 NA other upstream 267420 1503466 ~ 1517469 (-)
G109437 NA other upstream 1104119 2340203 ~ 2340758 (-)
CI01000019_03618642_03619707 NDUFB2 other upstream 2382304 3618388 ~ 3619973 (-)

Expression


Co-expression Network