G109706


Basic Information

Item Value
gene id G109706
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 3043876 ~ 3044079 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU124657
TGACGAACGCGGAAGCGCAAAGTGTAGAGCAAAACAAAACACCGGTCATGAATTAGAAGTCTAAAACAATCATTTTTAAAGAGAAATGTCAGAGGATTTCGATATAAGAGAAGAGGAGCTTGAGTTTGTTGCCCGGCCCTATTTGTTTGAACCATGAGAGGCGTCTAAGCTTACAATACTCCTACATCCTACGTCGACTTGCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU124657 True 204 lncRNA 0.42 1 3043876 3044079

Neighbor

gene id symbol gene type direction distance location
CI01000019_03000691_03020851 TRHDE coding downstream 23025 2999635 ~ 3020851 (-)
CI01000019_02907262_02983656 NA coding downstream 57937 2907170 ~ 2985939 (-)
CI01000019_02893150_02903846 NA coding downstream 139950 2891564 ~ 2903926 (-)
CI01000019_02601366_02629849 NA coding downstream 412727 2601059 ~ 2631149 (-)
CI01000019_02502701_02503852 NA coding downstream 540002 2502223 ~ 2503874 (-)
CI01000019_03055727_03057818 NA coding upstream 11375 3055454 ~ 3058001 (-)
CI01000019_03122047_03127637 MDM2 coding upstream 77463 3121542 ~ 3127637 (-)
CI01000019_03135155_03138908 NA coding upstream 90771 3134850 ~ 3138908 (-)
CI01000019_03319532_03331126 NA coding upstream 275070 3319149 ~ 3331313 (-)
CI01000019_03458890_03473706 GNAI1.L, GNAI1 coding upstream 414666 3458745 ~ 3473706 (-)
G109704 NA non-coding downstream 10677 3032827 ~ 3033199 (-)
G109693 NA non-coding downstream 85043 2958574 ~ 2958833 (-)
G109651 NA non-coding downstream 235005 2807241 ~ 2808871 (-)
G109625 NA non-coding downstream 282347 2760848 ~ 2761529 (-)
G109715 NA non-coding upstream 27268 3071347 ~ 3071879 (-)
G109753 NA non-coding upstream 98625 3142704 ~ 3142932 (-)
G109758 NA non-coding upstream 112227 3156306 ~ 3156537 (-)
G109766 NA non-coding upstream 124249 3168328 ~ 3169075 (-)
G109437 NA other downstream 703118 2340203 ~ 2340758 (-)
CI01000019_01503557_01515831 NA other downstream 1526039 1503466 ~ 1517469 (-)
G107820 NA other downstream 1564735 1478851 ~ 1479141 (-)
G107779 NA other downstream 1620059 1423565 ~ 1423817 (-)
CI01000019_03618642_03619707 NDUFB2 other upstream 574309 3618388 ~ 3619973 (-)
G110029 NA other upstream 816922 3861001 ~ 4015766 (-)
CI01000019_05571685_05572535 LAMTOR4 other upstream 2526861 5570940 ~ 5572535 (-)

Expression


Co-expression Network