G109753



Basic Information


Item Value
gene id G109753
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 3142704 ~ 3142932 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU124716
TTAAACTACAATACTAAAGTAAAAATAAAGTTAAATTAATGTTTTCTGTTTTCCGTGTTTACGTCCAAATGCCGGCTCAGTATTGGCCGAAGCTGATCACGTGAGCAGCATGTGTGTGATGCTGATGCAGGAGCCGGCCAATAATAAGTCTGCGTTCTCACGTAGAACCTGGAAGCACTGGACATAAACAACGTACGAGAATGGCACAGAAGAGAAGATATTGTTGAAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU124716 True 229 lncRNA 0.41 1 3142704 3142932

Neighbor


gene id symbol gene type direction distance location
CI01000019_03135155_03138908 NA coding downstream 3796 3134850 ~ 3138908 (-)
CI01000019_03122047_03127637 MDM2 coding downstream 15067 3121542 ~ 3127637 (-)
CI01000019_03055727_03057818 NA coding downstream 84703 3055454 ~ 3058001 (-)
CI01000019_03000691_03020851 TRHDE coding downstream 121853 2999635 ~ 3020851 (-)
CI01000019_02907262_02983656 NA coding downstream 156765 2907170 ~ 2985939 (-)
CI01000019_03319532_03331126 NA coding upstream 176217 3319149 ~ 3331313 (-)
CI01000019_03458890_03473706 GNAI1.L, GNAI1 coding upstream 315813 3458745 ~ 3473706 (-)
CI01000019_03487868_03518631 SEMA3C coding upstream 344892 3487824 ~ 3518853 (-)
CI01000019_03544753_03545061 NA coding upstream 401686 3544618 ~ 3546353 (-)
CI01000019_03618642_03619707 NDUFB2 coding upstream 475464 3618388 ~ 3619973 (-)
G109715 NA non-coding downstream 70825 3071347 ~ 3071879 (-)
G109706 NA non-coding downstream 98625 3043876 ~ 3044079 (-)
G109704 NA non-coding downstream 109505 3032827 ~ 3033199 (-)
G109693 NA non-coding downstream 183871 2958574 ~ 2958833 (-)
G109758 NA non-coding upstream 13374 3156306 ~ 3156537 (-)
G109766 NA non-coding upstream 25396 3168328 ~ 3169075 (-)
G109843 NA non-coding upstream 145155 3288087 ~ 3291802 (-)
G109794 NA non-coding upstream 170735 3313667 ~ 3318021 (-)
G109895 NA non-coding upstream 339064 3481996 ~ 3482986 (-)
G109437 NA other downstream 801946 2340203 ~ 2340758 (-)
CI01000019_01503557_01515831 NA other downstream 1624867 1503466 ~ 1517469 (-)
G107820 NA other downstream 1663563 1478851 ~ 1479141 (-)
G107779 NA other downstream 1718887 1423565 ~ 1423817 (-)
G110029 NA other upstream 718069 3861001 ~ 4015766 (-)
CI01000019_05571685_05572535 LAMTOR4 other upstream 2428008 5570940 ~ 5572535 (-)

Expression



Co-expression Network