G118638


Basic Information

Item Value
gene id G118638
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000021
NCBI id null
chromosome length 7014339
location 4781929 ~ 4783189 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU134762
AGGAAGCTGCCGTTGGCGTGTCCTGATCCGTCACATCCTGGTGTGGGACAGGTGGGGCCTTCTGTCTTAAACGCCTTCCAGGAGAATGGAGACCCGTTCAACAAACCCTCTTTCTGCCGCCTGGCCGCCAGCGGGCATCCATACGCACTGCGGTGAGTGGCATACTTCCCGCTGATGTGACCCAGGCTGTCACAACCCGGCACTGGGCATTTTAAGAGCTCGGAGTCCTCCTTGTCGTCCTTGATGGGAGTTGTTTTTATTCCACCTTTCTTGGCCCGTGGACACCCAGACAAACTGAAAATAGAGAGTATGCAGCTCATGATCAGAGGAGCCAGAAACTCAGAACAATAAG

Function

NR:

description
S-phase kinase-associated protein 2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU134762 True 352 lncRNA 0.55 2 4781929 4783189

Neighbor

gene id symbol gene type direction distance location
CI01000021_04567226_04567519 NA coding downstream 214313 4567147 ~ 4567616 (-)
CI01000021_04554591_04555147 NA coding downstream 226059 4554487 ~ 4555870 (-)
CI01000021_04529150_04530169 NPBWR2 coding downstream 251570 4528424 ~ 4530359 (-)
CI01000021_04248892_04258642 RGS19 coding downstream 523145 4248064 ~ 4258784 (-)
CI01000021_04191779_04194388 NA coding downstream 587530 4191606 ~ 4194399 (-)
CI01000021_04803637_04803849 NA coding upstream 19974 4803163 ~ 4803849 (-)
CI01000021_04807791_04818427 KIF3B coding upstream 23696 4806885 ~ 4820526 (-)
CI01000021_04822864_04825902 POFUT1 coding upstream 38977 4822166 ~ 4825902 (-)
CI01000021_04897640_04911504 TM9SF4 coding upstream 113245 4896434 ~ 4911504 (-)
CI01000021_04917237_04928702 HCK coding upstream 133032 4916221 ~ 4928702 (-)
G118640 NA non-coding downstream 5547 4775204 ~ 4776382 (-)
G118654 NA non-coding downstream 11522 4769792 ~ 4770407 (-)
G118628 NA non-coding downstream 40169 4741464 ~ 4741760 (-)
G118596 NA non-coding downstream 61001 4720706 ~ 4720928 (-)
G118579 NA non-coding downstream 83714 4697862 ~ 4698215 (-)
G118612 NA non-coding upstream 14145 4797334 ~ 4799261 (-)
G118701 NA non-coding upstream 184029 4967218 ~ 4967436 (-)
G118702 NA non-coding upstream 184372 4967561 ~ 4967779 (-)
G118705 NA non-coding upstream 190843 4974032 ~ 4974351 (-)
G118706 NA non-coding upstream 191483 4974672 ~ 4974994 (-)
G118639 NA other downstream 14557 4750097 ~ 4767372 (-)
CI01000021_04035411_04049515 CCM2L other downstream 732337 4035189 ~ 4049592 (-)
CI01000021_03902018_03931315 ACSS2 other downstream 850211 3901897 ~ 3932508 (-)
G117893 NA other downstream 1737142 3044019 ~ 3044787 (-)
G117683 NA other downstream 1889594 2891860 ~ 2892359 (-)
G118801 NA other upstream 370702 5153891 ~ 5154291 (-)
G119215 NA other upstream 741666 5524855 ~ 5530926 (-)
G119267 NA other upstream 830253 5613442 ~ 5613989 (-)
G119233 NA other upstream 997885 5781074 ~ 5782246 (-)
G119967 NA other upstream 2019666 6802855 ~ 6807625 (-)

Expression


Co-expression Network