G133681


Basic Information

Item Value
gene id G133681
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 10260145 ~ 10260357 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151997
CGGGAAGAGATCAGGAGGTCTCTAGGTTGCAAGGTTTAACACAGTCTTTTGCTGTGGCATTGACGCATAGTTTACACCCCTACACATTGTGCTGCATTAGATACAGTCAGTAAGTCAGAGATCCATCTTCTGAGAGTTAAATATCGGGCCACGCTTTTTGCCCTGGTGGAATTTATCCATCGTCTTTCAGCCTCTCACCCAATTAGTTTCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151997 True 213 lncRNA 0.45 1 10260145 10260357

Neighbor

gene id symbol gene type direction distance location
CI01000026_10234932_10250720 HEATR3 coding downstream 9425 10234932 ~ 10250720 (-)
CI01000026_10205804_10233324 PAPD5 coding downstream 25708 10205433 ~ 10234437 (-)
CI01000026_10151857_10176733 ADCY7 coding downstream 83412 10150667 ~ 10176733 (-)
CI01000026_10133129_10135047 NA coding downstream 124500 10132915 ~ 10135645 (-)
CI01000026_10035392_10061141 NKD1 coding downstream 197675 10035069 ~ 10062470 (-)
CI01000026_10347872_10351783 CEBPA coding upstream 87389 10347746 ~ 10351783 (-)
CI01000026_10421310_10440151 ABCC12 coding upstream 159802 10420159 ~ 10440927 (-)
CI01000026_10487830_10511296 SLC7A10A, SLC7A10 coding upstream 225458 10485815 ~ 10512739 (-)
CI01000026_10599580_10600367 NA coding upstream 338846 10599203 ~ 10600367 (-)
CI01000026_10658906_10667378 CELF1 coding upstream 398217 10658574 ~ 10667753 (-)
G133669 NA non-coding downstream 8717 10251189 ~ 10251428 (-)
G133154 NA non-coding downstream 191350 10068396 ~ 10068795 (-)
G133144 NA non-coding downstream 229480 10030121 ~ 10030665 (-)
G133143 NA non-coding downstream 231385 10028552 ~ 10028760 (-)
G133070 NA non-coding downstream 285705 9973684 ~ 9974440 (-)
G133683 NA non-coding upstream 973 10261330 ~ 10261585 (-)
G133643 NA non-coding upstream 94464 10354821 ~ 10355463 (-)
G133646 NA non-coding upstream 95295 10355652 ~ 10357541 (-)
G133706 NA non-coding upstream 100877 10361234 ~ 10361526 (-)
G133707 NA non-coding upstream 101451 10361808 ~ 10362007 (-)
G132721 NA other downstream 709501 9550030 ~ 9550644 (-)
G132575 NA other downstream 872429 9387151 ~ 9387716 (-)
G131742 NA other downstream 1952438 8306776 ~ 8307707 (-)
G130256 NA other downstream 3942991 6275511 ~ 6317154 (-)
G129750 NA other downstream 5440863 4785885 ~ 4820249 (-)
CI01000026_10788054_10788652 CD59 other upstream 526982 10787339 ~ 10789709 (-)
G133790 NA other upstream 573658 10834015 ~ 10859589 (-)
G133802 NA other upstream 1041558 11301915 ~ 11307181 (-)
G136110 NA other upstream 4294560 14554917 ~ 14555436 (-)

Expression


Co-expression Network