G133707


Basic Information

Item Value
gene id G133707
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 10361808 ~ 10362007 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152023
ATTGTGACATATGGGGCCATTAATGTTCGTCAAAGAAAAACATGTGCTTTTTCTACTAACAATGCAAATAAATCAAAGGAATCCCGGTCTTAATATTAGGCTTGAGGAATTGAATAGCTGAATGAGGTTCCCTGAGCACTGATGAGGTGCCTTAAAGTGTTAAAGGGATAGTTCACCCAAAAATGAAAATTCTGTCATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152023 True 200 lncRNA 0.37 1 10361808 10362007

Neighbor

gene id symbol gene type direction distance location
CI01000026_10347872_10351783 CEBPA coding downstream 10025 10347746 ~ 10351783 (-)
CI01000026_10234932_10250720 HEATR3 coding downstream 111088 10234932 ~ 10250720 (-)
CI01000026_10205804_10233324 PAPD5 coding downstream 127371 10205433 ~ 10234437 (-)
CI01000026_10151857_10176733 ADCY7 coding downstream 185075 10150667 ~ 10176733 (-)
CI01000026_10133129_10135047 NA coding downstream 226163 10132915 ~ 10135645 (-)
CI01000026_10421310_10440151 ABCC12 coding upstream 58152 10420159 ~ 10440927 (-)
CI01000026_10487830_10511296 SLC7A10A, SLC7A10 coding upstream 123808 10485815 ~ 10512739 (-)
CI01000026_10599580_10600367 NA coding upstream 237196 10599203 ~ 10600367 (-)
CI01000026_10658906_10667378 CELF1 coding upstream 296567 10658574 ~ 10667753 (-)
CI01000026_10695298_10696443 C1QTNF4 coding upstream 332788 10694795 ~ 10696652 (-)
G133706 NA non-coding downstream 282 10361234 ~ 10361526 (-)
G133646 NA non-coding downstream 4267 10355652 ~ 10357541 (-)
G133643 NA non-coding downstream 6345 10354821 ~ 10355463 (-)
G133683 NA non-coding downstream 100223 10261330 ~ 10261585 (-)
G133681 NA non-coding downstream 101451 10260145 ~ 10260357 (-)
G133708 NA non-coding upstream 1790 10363797 ~ 10364007 (-)
G133709 NA non-coding upstream 2138 10364145 ~ 10364363 (-)
G133713 NA non-coding upstream 4458 10366465 ~ 10366693 (-)
G133722 NA non-coding upstream 15688 10377695 ~ 10377928 (-)
G133723 NA non-coding upstream 16213 10378220 ~ 10378434 (-)
G132721 NA other downstream 811164 9550030 ~ 9550644 (-)
G132575 NA other downstream 974092 9387151 ~ 9387716 (-)
G131742 NA other downstream 2054101 8306776 ~ 8307707 (-)
G130256 NA other downstream 4044654 6275511 ~ 6317154 (-)
CI01000026_10788054_10788652 CD59 other upstream 425332 10787339 ~ 10789709 (-)
G133790 NA other upstream 472008 10834015 ~ 10859589 (-)
G133802 NA other upstream 939908 11301915 ~ 11307181 (-)
G136110 NA other upstream 4192910 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 6394722 16756729 ~ 16761341 (-)

Expression


Co-expression Network