G133723


Basic Information

Item Value
gene id G133723
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 10378220 ~ 10378434 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152039
CTGAGAACTACCCTTTTTTTGTCTTTTCTGGGGTCTGATCAATCACATTCTCTTTTGACTGGGAGGATACATATCTTTCCCTATGGAAATCATCCATTGTACACAAGTTGTACTCTTGCTTAAAGAGTAAAAAGTGTTTTTTACTGAGTACACTGCTTGTTGGAATGTGTTGAGGTAGACTATAATATGTGGGCACTCTACAGTCTTATCTGCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152039 True 215 lncRNA 0.38 1 10378220 10378434

Neighbor

gene id symbol gene type direction distance location
CI01000026_10347872_10351783 CEBPA coding downstream 26437 10347746 ~ 10351783 (-)
CI01000026_10234932_10250720 HEATR3 coding downstream 127500 10234932 ~ 10250720 (-)
CI01000026_10205804_10233324 PAPD5 coding downstream 143783 10205433 ~ 10234437 (-)
CI01000026_10151857_10176733 ADCY7 coding downstream 201487 10150667 ~ 10176733 (-)
CI01000026_10133129_10135047 NA coding downstream 242575 10132915 ~ 10135645 (-)
CI01000026_10421310_10440151 ABCC12 coding upstream 41725 10420159 ~ 10440927 (-)
CI01000026_10487830_10511296 SLC7A10A, SLC7A10 coding upstream 107381 10485815 ~ 10512739 (-)
CI01000026_10599580_10600367 NA coding upstream 220769 10599203 ~ 10600367 (-)
CI01000026_10658906_10667378 CELF1 coding upstream 280140 10658574 ~ 10667753 (-)
CI01000026_10695298_10696443 C1QTNF4 coding upstream 316361 10694795 ~ 10696652 (-)
G133722 NA non-coding downstream 292 10377695 ~ 10377928 (-)
G133713 NA non-coding downstream 11527 10366465 ~ 10366693 (-)
G133709 NA non-coding downstream 13857 10364145 ~ 10364363 (-)
G133708 NA non-coding downstream 14213 10363797 ~ 10364007 (-)
G133707 NA non-coding downstream 16213 10361808 ~ 10362007 (-)
G133724 NA non-coding upstream 130 10378564 ~ 10378815 (-)
G133757 NA non-coding upstream 70968 10449402 ~ 10449626 (-)
G133758 NA non-coding upstream 72138 10450572 ~ 10450771 (-)
G133733 NA non-coding upstream 76739 10455173 ~ 10455581 (-)
G133730 NA non-coding upstream 78391 10456825 ~ 10457973 (-)
G132721 NA other downstream 827576 9550030 ~ 9550644 (-)
G132575 NA other downstream 990504 9387151 ~ 9387716 (-)
G131742 NA other downstream 2070513 8306776 ~ 8307707 (-)
G130256 NA other downstream 4061066 6275511 ~ 6317154 (-)
CI01000026_10788054_10788652 CD59 other upstream 408905 10787339 ~ 10789709 (-)
G133790 NA other upstream 455581 10834015 ~ 10859589 (-)
G133802 NA other upstream 923481 11301915 ~ 11307181 (-)
G136110 NA other upstream 4176483 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 6378295 16756729 ~ 16761341 (-)

Expression


Co-expression Network