G134678


Basic Information

Item Value
gene id G134678
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12636585 ~ 12636798 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU153148
ATAGCTTAGATGGCACTCTTGGCATTTCTCGAAGATCTTGCTGCGCTGCACTCAGGTGAGAACACGTCTTTAGAGAGCGTCATGTTTGCTGAGAGTGACGAAAGAAAAAGGGTGTGTGGAATGCCTTTATATGGATGTGGTTTGTTCGTGTTTTAAGAATACTCCGAATTCATCAACATTAGAACGAGGTTAAGAACAAATTCATGTGTAAACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU153148 True 214 lncRNA 0.42 1 12636585 12636798

Neighbor

gene id symbol gene type direction distance location
CI01000026_12591049_12624688 PRKDC coding downstream 10147 12590785 ~ 12626438 (-)
CI01000026_12570957_12581387 NA coding downstream 55072 12570795 ~ 12581513 (-)
CI01000026_12536781_12546106 KIF9 coding downstream 90056 12536781 ~ 12546529 (-)
CI01000026_12445673_12447183 NA coding downstream 187884 12445304 ~ 12448701 (-)
CI01000026_12444311_12444646 NA coding downstream 191723 12443976 ~ 12444862 (-)
CI01000026_12639230_12645878 ASB10, ABCF2B, ABCF2, ABCF2A coding upstream 2147 12638945 ~ 12645878 (-)
CI01000026_12663161_12672818 SMARCD3A, SMARCD3B, SMARCD3 coding upstream 24466 12661264 ~ 12672818 (-)
CI01000026_12712643_12726107 NFX1 coding upstream 75801 12712599 ~ 12726107 (-)
CI01000026_12728675_12752693 NA coding upstream 91791 12728589 ~ 12752693 (-)
CI01000026_12792682_12819124 MALRD1 coding upstream 155884 12792682 ~ 12819124 (-)
G134676 NA non-coding downstream 885 12635318 ~ 12635700 (-)
G134674 NA non-coding downstream 2110 12633349 ~ 12634475 (-)
G134673 NA non-coding downstream 4273 12630223 ~ 12632312 (-)
G134619 NA non-coding downstream 46467 12587948 ~ 12590118 (-)
G134593 NA non-coding downstream 79252 12550311 ~ 12557333 (-)
G134680 NA non-coding upstream 145917 12782715 ~ 12782993 (-)
G134916 NA non-coding upstream 196388 12833186 ~ 12833432 (-)
G134921 NA non-coding upstream 212555 12849353 ~ 12849780 (-)
G134931 NA non-coding upstream 230453 12867251 ~ 12871739 (-)
G134986 NA non-coding upstream 381070 13017868 ~ 13018078 (-)
G133802 NA other downstream 1329404 11301915 ~ 11307181 (-)
G133790 NA other downstream 1798980 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 1846431 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 2287628 10347746 ~ 10351783 (-)
G132721 NA other downstream 3085941 9550030 ~ 9550644 (-)
G136110 NA other upstream 1918119 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 4119931 16756729 ~ 16761341 (-)
G137667 NA other upstream 4169566 16806364 ~ 16808372 (-)
G137914 NA other upstream 4346453 16983251 ~ 16984352 (-)
G137967 NA other upstream 4431550 17068348 ~ 17069433 (-)

Expression


Co-expression Network