G134680


Basic Information

Item Value
gene id G134680
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12782715 ~ 12782993 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU153150
GAAAATTAGAATATTGTGAAAAGGTTCAATATTGAAGACACCTGGTGTCACACTCTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAGAGGCGAAGGGA

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU153150 True 279 lncRNA 0.43 1 12782715 12782993

Neighbor

gene id symbol gene type direction distance location
CI01000026_12728675_12752693 NA coding downstream 30022 12728589 ~ 12752693 (-)
CI01000026_12712643_12726107 NFX1 coding downstream 56608 12712599 ~ 12726107 (-)
CI01000026_12663161_12672818 SMARCD3A, SMARCD3B, SMARCD3 coding downstream 109897 12661264 ~ 12672818 (-)
CI01000026_12639230_12645878 ASB10, ABCF2B, ABCF2, ABCF2A coding downstream 136837 12638945 ~ 12645878 (-)
CI01000026_12591049_12624688 PRKDC coding downstream 156277 12590785 ~ 12626438 (-)
CI01000026_12792682_12819124 MALRD1 coding upstream 9689 12792682 ~ 12819124 (-)
CI01000026_12884442_12887984 ARL8, ARL5B coding upstream 100778 12883771 ~ 12887984 (-)
CI01000026_12900826_12904700 NA coding upstream 117795 12900788 ~ 12905085 (-)
CI01000026_12934742_12962957 DKFZP468J242, VPS35 coding upstream 151749 12934742 ~ 12962957 (-)
CI01000026_12985635_12997297 NA coding upstream 202369 12985362 ~ 12997297 (-)
G134678 NA non-coding downstream 145917 12636585 ~ 12636798 (-)
G134676 NA non-coding downstream 147015 12635318 ~ 12635700 (-)
G134674 NA non-coding downstream 148240 12633349 ~ 12634475 (-)
G134673 NA non-coding downstream 150403 12630223 ~ 12632312 (-)
G134619 NA non-coding downstream 192597 12587948 ~ 12590118 (-)
G134916 NA non-coding upstream 50193 12833186 ~ 12833432 (-)
G134921 NA non-coding upstream 66360 12849353 ~ 12849780 (-)
G134931 NA non-coding upstream 84258 12867251 ~ 12871739 (-)
G134986 NA non-coding upstream 234875 13017868 ~ 13018078 (-)
G135007 NA non-coding upstream 412274 13195267 ~ 13195982 (-)
G133802 NA other downstream 1475534 11301915 ~ 11307181 (-)
G133790 NA other downstream 1945110 10834015 ~ 10859589 (-)
CI01000026_10788054_10788652 CD59 other downstream 1992561 10787339 ~ 10789709 (-)
CI01000026_10347872_10351783 CEBPA other downstream 2433758 10347746 ~ 10351783 (-)
G132721 NA other downstream 3232071 9550030 ~ 9550644 (-)
G136110 NA other upstream 1771924 14554917 ~ 14555436 (-)
CI01000026_16756776_16760261 RBPMS2A, RBPMS2B, RBPMS2 other upstream 3973736 16756729 ~ 16761341 (-)
G137667 NA other upstream 4023371 16806364 ~ 16808372 (-)
G137914 NA other upstream 4200258 16983251 ~ 16984352 (-)
G137967 NA other upstream 4285355 17068348 ~ 17069433 (-)

Expression


Co-expression Network