Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_008490

Basic Information

Item	Value
gene id	XLOC_008490
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007126.7
NCBI id	CM002899.2
chromosome length	48040578
location	23207159 ~ 23207464 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00018954
GTTTTACAGGCGGAACAGGAAGAGCAGTCACACGAGCATAGGAGGGGGAGAAAGGGAGAAAGGCGGCGTTAACCCTAATATGTCTGTTTAGTTTTGCTGGGAAGCCCTCGTGTCTTGTCAGGCCGAACTTCCCGTTGCAAAAGTAATGATGGGAAGTTCAATTCATTTACGCGAATCGGCTCTTTAGAACAAGGCCTCATTAAGAACCGATTCTAT

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00018954	True	216	lncRNA	0.47	2	23207159	23207464

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_008489	grik4	coding	upstream	18265	22722682 ~ 23188894 (+)
XLOC_008488	NA	coding	upstream	646022	22541344 ~ 22561137 (+)
XLOC_008487	arhgef12a	coding	upstream	668316	22448456 ~ 22538843 (+)
XLOC_008486	tlcd5a	coding	upstream	762413	22435460 ~ 22444746 (+)
XLOC_008484	oafa	coding	upstream	775574	22390076 ~ 22431585 (+)
XLOC_008491	cbl	coding	downstream	578	23208042 ~ 23265405 (+)
XLOC_008492	NA	coding	downstream	59194	23266658 ~ 23268377 (+)
XLOC_008493	rnf26	coding	downstream	149136	23356600 ~ 23358807 (+)
XLOC_008494	CR847979.1	coding	downstream	170607	23378071 ~ 23378188 (+)
XLOC_008495	phykpl	coding	downstream	236201	23443665 ~ 23451449 (+)
XLOC_008463	BX663520.1	misc	upstream	1954877	21252191 ~ 21252282 (+)
XLOC_008485	CR848033.1	non-coding	upstream	792906	22414124 ~ 22414253 (+)
XLOC_008483	NA	non-coding	upstream	840637	22351365 ~ 22366522 (+)
XLOC_008478	BX572077.3	non-coding	upstream	1203963	22003082 ~ 22003196 (+)
XLOC_008474	NA	non-coding	upstream	1346742	21780598 ~ 21860417 (+)
XLOC_008496	NA	non-coding	downstream	260520	23467984 ~ 23505657 (+)
XLOC_008505	NA	non-coding	downstream	792105	23999569 ~ 24005283 (+)
XLOC_008506	NA	non-coding	downstream	925090	24132554 ~ 24132837 (+)

Expression

Co-expression Network