CI01000028_00129953_00131814 (YIF1B)


Basic Information

Item Value
gene id CI01000028_00129953_00131814
gene name YIF1B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 129854 ~ 131814 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000028_00129953_00131814.mRNA
AACTGGGAGGTGAGCTATCAGCAGGATACACCAGTTGCGCCACGGTTTGATATCAACGCCCCTGATCTGTACATTCCCGTGATGGGTTTCATTACGTATGTCCTGGTTGCAGGACTGGCTTTGGGCACACAGAACCGGTTTTCTCCAGAGATTCTTGGGATTCAGGCTAGCTCGGCCCTGGTATGGCTCATTATCGAGGTTTTGGCTGTGCTCCTCAGTCTTTATCTGGTGACCGTTAACACTGACCTCACCACCATCGACCTGGTGGCCTTTTCTGGATACAAATATGTTGGGTTCAATCTACTTGGGGTCAAATTCTGCTGGTATTTTGGACTCTAGGTGGTGCTGTTGGGTAATATTTGCTGCACAGTTACCTATCCTTTACATTTTTTATTATTATTATTTTATCTAAACATGAAAAAGAAACTGAAAAATAAA

Function

symbol description
yif1b Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport. Predicted to act upstream of or within protein transport. Predicted to be located in Golgi apparatus and endoplasmic reticulum. Predicted to be active in COPII-coated ER to Golgi transport vesicle; endoplasmic reticulum membrane; and endoplasmic reticulum-Golgi intermediate compartment. Predicted to be integral component of Golgi membrane. Orthologous to human YIF1B (Yip1 interacting factor homolog B, membrane trafficking protein).

GO:

id name namespace
GO:0003674 molecular_function molecular_function

KEGG:

id description
K20362 YIF1; protein transport protein YIF1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000028_00129953_00131814.mRNA True 438 mRNA 0.44 4 129854 131814

Neighbor

gene id symbol gene type direction distance location
CI01000028_00133579_00134596 NA coding upstream 1765 133579 ~ 134802 (-)
CI01000028_00137862_00152223 NA coding upstream 6048 137862 ~ 152223 (-)
CI01000028_00331781_00342935 SHKBP1 coding upstream 199354 331168 ~ 342935 (-)
CI01000028_00346500_00350741 NA coding upstream 214611 346425 ~ 352059 (-)
CI01000028_00363732_00407780 PPP1R37 coding upstream 231292 363106 ~ 408176 (-)
G144823 NA non-coding downstream 5813 99964 ~ 124041 (-)
G144825 NA non-coding downstream 27154 76010 ~ 102700 (-)
G144832 NA non-coding downstream 70159 59469 ~ 59695 (-)
G144830 NA non-coding downstream 70823 58683 ~ 59031 (-)
G144806 NA non-coding downstream 103532 25951 ~ 26322 (-)
G144855 NA non-coding upstream 4577 135392 ~ 137202 (-)
G144827 NA non-coding upstream 29434 161248 ~ 192616 (-)
G144915 NA non-coding upstream 82725 214539 ~ 246074 (-)
G144946 NA non-coding upstream 287990 419804 ~ 420120 (-)
G144952 NA non-coding upstream 318733 450547 ~ 451153 (-)
CI01000028_00474810_00475211 NA other upstream 341795 473609 ~ 475211 (-)
G146190 NA other upstream 1965756 2097570 ~ 2111265 (-)
G146238 NA other upstream 2015564 2147378 ~ 2160038 (-)
CI01000028_02441408_02445596 RPL35A, GM10247 other upstream 2309518 2441332 ~ 2445596 (-)

Expression


Co-expression Network