G146106



Basic Information


Item Value
gene id G146106
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 1838925 ~ 1855036 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU166014
GTGTGCGCGGTTCTTGTTATGAGGTGTGGTGGAACACAGCTCGATGGCTTCAGGTTCATGAAAGATCACCGTAGGCAGTGGGTCCTTCCGGAGCGTCAGCACGTTGAGTTTGGTCTTAAGCATTGTCTGTAAATCTGCAATCGCTCCGACGCAGGCTGCCACATTTTAGTAGATGATACGCTCGATTGTCAGGCTGGAAACAAGGATAGCCCAGCTATAACATCTGCTCGCTGGCGGCGCTTTCTCGCTCCTTCTGTCTCCTCCACAAATCCCGAGGAAAAAAATACAGATACAGTGAATTCCAACGGTGCGCAAGAACGAAACTCCGCCTGCGAAAACACGCACGGGCTCTTTTCTTTCTTTCTCTCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU166014 True 369 lncRNA 0.51 2 1838925 1855036

Neighbor


gene id symbol gene type direction distance location
CI01000028_01770721_01773265 NA coding downstream 65581 1769608 ~ 1773344 (-)
CI01000028_01707320_01709779 NA coding downstream 128319 1706758 ~ 1710606 (-)
CI01000028_01582515_01591864 NA coding downstream 246757 1582029 ~ 1592168 (-)
CI01000028_01403859_01408636 NA coding downstream 430245 1403706 ~ 1408680 (-)
CI01000028_01381059_01398155 BARX2 coding downstream 440568 1379172 ~ 1398357 (-)
CI01000028_02036977_02046469 DAW1 coding upstream 181273 2036309 ~ 2046469 (-)
CI01000028_02187324_02188153 NA coding upstream 331559 2186595 ~ 2188153 (-)
CI01000028_02190605_02195586 NA coding upstream 335532 2190568 ~ 2195964 (-)
CI01000028_02308696_02319050 MMP23BB coding upstream 453367 2308403 ~ 2319050 (-)
CI01000028_02327402_02338641 AP2M1, AP2M1.L, AP2M1A, AP2M1B coding upstream 472144 2327180 ~ 2338641 (-)
G146122 NA non-coding downstream 649 1838075 ~ 1838276 (-)
G146117 NA non-coding downstream 4905 1816826 ~ 1834020 (-)
G146064 NA non-coding downstream 83385 1750999 ~ 1755540 (-)
G146052 NA non-coding downstream 116351 1720025 ~ 1722574 (-)
G146103 NA non-coding upstream 12275 1867311 ~ 1871322 (-)
G146131 NA non-coding upstream 18541 1873577 ~ 1873958 (-)
G146132 NA non-coding upstream 18998 1874034 ~ 1874436 (-)
G146134 NA non-coding upstream 23009 1878045 ~ 1878322 (-)
G146148 NA non-coding upstream 44659 1899695 ~ 1899946 (-)
CI01000028_00474810_00475211 NA other downstream 1363579 473609 ~ 475211 (-)
G144855 NA other downstream 1703049 135392 ~ 137202 (-)
G146190 NA other upstream 242534 2097570 ~ 2111265 (-)
G146238 NA other upstream 292342 2147378 ~ 2160038 (-)
CI01000028_02441408_02445596 RPL35A, GM10247 other upstream 586296 2441332 ~ 2445596 (-)
G149329 NA other upstream 4844477 6699513 ~ 6701240 (-)
CI01000028_06969947_06983352 NA other upstream 5115721 6965064 ~ 6984084 (-)

Expression



Co-expression Network