G145591


Basic Information

Item Value
gene id G145591
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 2490137 ~ 2490403 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU165428
CTGATGAACACAATCCGAGTTATATTAATAAATATCCTGACGCGTTCAGGCTTTATAATGGCAGTGAACGGGACCAACGAGTTTGAAGCCCAAGAAAGCACATCCATCCATCATAAACGTATTCCACACGGCCCGGGAGGGTTAATAAAGGCCTTCTATGCATTTGTGTAAGAAAAATATCTATATTTAACATGTCATGAAGTAAAATATCTAGCTTCTGCCAGACCGCCTTCCGTATTCAACTTACGAAGTATAATGCCACTCTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU165428 True 267 lncRNA 0.40 1 2490137 2490403

Neighbor

gene id symbol gene type direction distance location
CI01000028_02452520_02473148 CSTF3.S, CSTF3 coding upstream 16536 2452520 ~ 2473601 (+)
CI01000028_02299641_02304780 PCYT1A, PCYT1AB coding upstream 185076 2299402 ~ 2305061 (+)
CI01000028_02211495_02287691 SPTBN4 coding upstream 202089 2211495 ~ 2288048 (+)
CI01000028_02175774_02182966 KCNK6 coding upstream 306677 2175524 ~ 2183460 (+)
CI01000028_02165692_02171949 NA coding upstream 317193 2165692 ~ 2172944 (+)
CI01000028_02568775_02584510 WT1B coding downstream 78372 2568775 ~ 2584889 (+)
CI01000028_02738747_02743091 NA coding downstream 248080 2738483 ~ 2743091 (+)
CI01000028_02915708_02935354 NA coding downstream 425110 2915513 ~ 2935430 (+)
CI01000028_03053581_03067840 PEX16 coding downstream 563051 3053454 ~ 3068508 (+)
CI01000028_03074166_03080440 NA coding downstream 583636 3074039 ~ 3080902 (+)
G145589 NA non-coding upstream 1641 2488093 ~ 2488496 (+)
G145590 NA non-coding upstream 5936 2483794 ~ 2484201 (+)
G145587 NA non-coding upstream 8066 2481781 ~ 2482071 (+)
G145588 NA non-coding upstream 8480 2480550 ~ 2481657 (+)
G145586 NA non-coding upstream 11681 2477721 ~ 2478456 (+)
G145592 NA non-coding downstream 3574 2493977 ~ 2494188 (+)
G145595 NA non-coding downstream 10065 2500468 ~ 2500736 (+)
G145599 NA non-coding downstream 32391 2522794 ~ 2523076 (+)
G145613 NA non-coding downstream 74403 2564806 ~ 2565025 (+)
G145615 NA non-coding downstream 76232 2566635 ~ 2566924 (+)
CI01000028_00525538_00533862 NA other upstream 1968206 524647 ~ 535245 (+)
G145843 NA other downstream 532743 3023146 ~ 3024220 (+)
G147462 NA other downstream 2468300 4958703 ~ 4989838 (+)
G147636 NA other downstream 2725687 5216090 ~ 5216611 (+)
G147693 NA other downstream 2950051 5440454 ~ 5453610 (+)
CI01000028_07470324_07471346 NA other downstream 4979489 7469543 ~ 7471432 (+)

Expression


Co-expression Network