G145615


Basic Information

Item Value
gene id G145615
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 2566635 ~ 2566924 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU165461
GCTCAGGAATACTTCCAGAAAACATTATCGGTGAACACAATCCACCGTGCCATTCGCCGTTGCCGGCTAAAACTCTATAGGTCAAAAAAGAAGCCATATCTAAACATGATCCAGAAGCGCAGGCGTTTTCTCTGGGCCAAGGCTCATTTAAAATGGACTGTGGCAAAGTGGAAAACTGTTCTGTGGTCAGATGAATCAAAATTTGAAGTTCTTTTTGGAAAACTGGGACGCCATGTCATCCGGACTAAAGAGGACAAGGACAACCCAAGTTGTTATCAGCGCTCAGTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU165461 True 290 lncRNA 0.44 1 2566635 2566924

Neighbor

gene id symbol gene type direction distance location
CI01000028_02452520_02473148 CSTF3.S, CSTF3 coding upstream 93034 2452520 ~ 2473601 (+)
CI01000028_02299641_02304780 PCYT1A, PCYT1AB coding upstream 261574 2299402 ~ 2305061 (+)
CI01000028_02211495_02287691 SPTBN4 coding upstream 278587 2211495 ~ 2288048 (+)
CI01000028_02175774_02182966 KCNK6 coding upstream 383175 2175524 ~ 2183460 (+)
CI01000028_02165692_02171949 NA coding upstream 393691 2165692 ~ 2172944 (+)
CI01000028_02568775_02584510 WT1B coding downstream 1851 2568775 ~ 2584889 (+)
CI01000028_02738747_02743091 NA coding downstream 171559 2738483 ~ 2743091 (+)
CI01000028_02915708_02935354 NA coding downstream 348589 2915513 ~ 2935430 (+)
CI01000028_03053581_03067840 PEX16 coding downstream 486530 3053454 ~ 3068508 (+)
CI01000028_03074166_03080440 NA coding downstream 507115 3074039 ~ 3080902 (+)
G145613 NA non-coding upstream 1610 2564806 ~ 2565025 (+)
G145599 NA non-coding upstream 43559 2522794 ~ 2523076 (+)
G145595 NA non-coding upstream 65899 2500468 ~ 2500736 (+)
G145592 NA non-coding upstream 72447 2493977 ~ 2494188 (+)
G145591 NA non-coding upstream 76232 2490137 ~ 2490403 (+)
G145621 NA non-coding downstream 19234 2586158 ~ 2586703 (+)
G145525 NA non-coding downstream 24973 2591897 ~ 2635952 (+)
G145641 NA non-coding downstream 95384 2662308 ~ 2662547 (+)
G145643 NA non-coding downstream 98408 2665332 ~ 2734256 (+)
G145682 NA non-coding downstream 179281 2746205 ~ 2746423 (+)
CI01000028_00525538_00533862 NA other upstream 2044704 524647 ~ 535245 (+)
G145843 NA other downstream 456222 3023146 ~ 3024220 (+)
G147462 NA other downstream 2391779 4958703 ~ 4989838 (+)
G147636 NA other downstream 2649166 5216090 ~ 5216611 (+)
G147693 NA other downstream 2873530 5440454 ~ 5453610 (+)
CI01000028_07470324_07471346 NA other downstream 4902968 7469543 ~ 7471432 (+)

Expression


Co-expression Network