G149456


Basic Information

Item Value
gene id G149456
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 6828287 ~ 6828493 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU169757
AAACAATGCAACGCAATGCGATGTTTAGAAACCTCATAATCCACTACTTTATTTATGATCTTGTCAATGACAGCAGCCCAAATTACAGGGAATTTCAGTCTTTTTTGTGTGTTTTGCTGTAGCTATTGCTGAGGAGTTATTTTCATAGTTAGACACCACACTAGCCAGCAGAGCTATTAAGAGGTTGGGTTTGGGTTTTGTAGTCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU169757 True 207 lncRNA 0.38 1 6828287 6828493

Neighbor

gene id symbol gene type direction distance location
CI01000028_06756364_06785862 TMOD3, TMOD2 coding downstream 39697 6756343 ~ 6788590 (-)
CI01000028_06736522_06738241 LYSMD2 coding downstream 90046 6736480 ~ 6738241 (-)
CI01000028_06681287_06690095 ACADL.L, ACADL coding downstream 138119 6681168 ~ 6690168 (-)
CI01000028_06565728_06571617 GLDN coding downstream 256265 6564707 ~ 6572022 (-)
CI01000028_06199637_06208451 NA coding downstream 619294 6198701 ~ 6208993 (-)
CI01000028_06930121_06933901 BCL2L10 coding upstream 101330 6929823 ~ 6934781 (-)
CI01000028_06937034_06956621 GNB5B coding upstream 108325 6936818 ~ 6956621 (-)
CI01000028_06969947_06983352 NA coding upstream 139856 6965064 ~ 6984084 (-)
CI01000028_07010842_07012858 NA coding upstream 181330 7009823 ~ 7012858 (-)
CI01000028_07102169_07103695 NA coding upstream 273634 7102127 ~ 7103717 (-)
G149451 NA non-coding downstream 9872 6818177 ~ 6818415 (-)
G149331 NA non-coding downstream 29894 6796588 ~ 6798393 (-)
G149328 NA non-coding downstream 73002 6754339 ~ 6755285 (-)
G149429 NA non-coding downstream 86705 6741383 ~ 6741582 (-)
G149428 NA non-coding downstream 99805 6728248 ~ 6728482 (-)
G149494 NA non-coding upstream 30908 6859401 ~ 6859730 (-)
G149471 NA non-coding upstream 65372 6893865 ~ 6894142 (-)
G149503 NA non-coding upstream 66438 6894931 ~ 6895716 (-)
G149504 NA non-coding upstream 68171 6896664 ~ 6897347 (-)
G149506 NA non-coding upstream 72121 6900614 ~ 6900937 (-)
G149329 NA other downstream 127047 6699513 ~ 6701240 (-)
CI01000028_02441408_02445596 RPL35A, GM10247 other downstream 4381974 2441332 ~ 2445596 (-)
G146238 NA other downstream 4668249 2147378 ~ 2160038 (-)
G146190 NA other downstream 4717022 2097570 ~ 2111265 (-)
CI01000028_00474810_00475211 NA other downstream 6352941 473609 ~ 475211 (-)
G149474 NA other upstream 401298 7229791 ~ 7232783 (-)
CI01000028_07527725_07535631 ARPP19 other upstream 697469 7525962 ~ 7535743 (-)
G149923 NA other upstream 1146075 7974568 ~ 8024244 (-)
G150328 NA other upstream 1864905 8693398 ~ 8693743 (-)

Expression


Co-expression Network