G163435


Basic Information

Item Value
gene id G163435
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 7727193 ~ 7727403 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU185683
TCAGAAGTTACTCTTTTGGCGTAAGTCGACTTGCGTAGGCCGTCTGCCAGAAGCTAGTTATTTTATAAAGTTTTAAATATGGATATTTTTCTTACAAAAACCCATCGCTTCACTTCAGAAGGCCTTTATTAACCCCCTGGAGTGGTATGGATTACTTTCATGATGGATGGATGCACTTTTTTGGACTTCAAAATCAGGAGCACCATTCACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU185683 True 211 lncRNA 0.39 1 7727193 7727403

Neighbor

gene id symbol gene type direction distance location
CI01000030_07716863_07718632 ENC1.2, ENC3, PEX11G, ENC1.2.L coding downstream 8074 7716717 ~ 7719119 (-)
CI01000030_07710486_07714016 NA coding downstream 13042 7709796 ~ 7714151 (-)
CI01000030_07548087_07549591 NA coding downstream 177247 7547512 ~ 7549946 (-)
CI01000030_07494612_07513546 NA coding downstream 213015 7493560 ~ 7514178 (-)
CI01000030_07438282_07471671 BCOR coding downstream 253396 7437214 ~ 7473797 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 coding upstream 8343 7735436 ~ 7737720 (-)
CI01000030_07749038_07754607 NEWGENE_1305281, HIAT1B, MFSD14A, MFSD14A.L coding upstream 21383 7748786 ~ 7754607 (-)
CI01000030_07761302_07764226 ABHEA, ABHD14A coding upstream 33899 7761302 ~ 7764226 (-)
CI01000030_07769918_07776928 HYAL2B coding upstream 41545 7768948 ~ 7776928 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 coding upstream 61405 7788797 ~ 7792198 (-)
G163433 NA non-coding downstream 23484 7703408 ~ 7703709 (-)
G163416 NA non-coding downstream 71579 7655039 ~ 7655614 (-)
G163415 NA non-coding downstream 74215 7652602 ~ 7652978 (-)
G163181 NA non-coding downstream 75308 7649830 ~ 7651885 (-)
G163338 NA non-coding downstream 122306 7603173 ~ 7604887 (-)
G163439 NA non-coding upstream 53841 7781244 ~ 7781552 (-)
CI01000030_07802211_07804196 NA non-coding upstream 74729 7802049 ~ 7804223 (-)
G163445 NA non-coding upstream 102288 7829691 ~ 7830607 (-)
G163448 NA non-coding upstream 116409 7843812 ~ 7844268 (-)
G163449 NA non-coding upstream 117617 7845020 ~ 7845475 (-)
G163139 NA other downstream 577049 7149474 ~ 7150144 (-)
G163065 NA other downstream 801536 6924483 ~ 6925657 (-)
CI01000030_06747047_06752255 NA other downstream 974782 6746960 ~ 6752411 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other downstream 1022448 6701055 ~ 6704745 (-)
CI01000030_06131710_06138371 NA other downstream 1588787 6131090 ~ 6138406 (-)
CI01000030_08185866_08194632 NA other upstream 464516 8184897 ~ 8197266 (-)
G163873 NA other upstream 1206010 8933413 ~ 8933982 (-)
CI01000030_09277337_09294501 NA other upstream 1559803 9276431 ~ 9294802 (-)

Expression


Co-expression Network