G164094



Basic Information


Item Value
gene id G164094
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9544721 ~ 9544941 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU186425
CGGAGACAAGGGAACAGGTAAGTAGCAAGGAGAGTCCTTGAGGTAAGCATACAGGTAAGTCCTTTGATGCAAACGAGACCAGACAATGTGACTGTGTGTGTGAGTGTCTTAAGTAGTGCTGGTGATGAGTGAGCTGATGAGGTGCAGGTGGCGGTGATTAGTACTCCGGGGAAGGTGTGCGCTGTGATTGGTGGATGTTGGAGCCTGGCGTGTCTGTGACA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU186425 True 221 lncRNA 0.52 1 9544721 9544941

Neighbor


gene id symbol gene type direction distance location
CI01000030_09500443_09502785 NA coding downstream 41859 9500263 ~ 9502862 (-)
CI01000030_09448873_09453673 NA coding downstream 90629 9448772 ~ 9454092 (-)
CI01000030_09433282_09440636 NA coding downstream 103633 9432916 ~ 9441088 (-)
CI01000030_09382055_09418356 NA coding downstream 125674 9381984 ~ 9419047 (-)
CI01000030_09277337_09294501 NA coding downstream 249919 9276431 ~ 9294802 (-)
CI01000030_09561245_09573575 NA coding upstream 16221 9561162 ~ 9574107 (-)
CI01000030_09579086_09594020 NA coding upstream 34123 9579064 ~ 9594113 (-)
CI01000030_09639163_09647509 NA coding upstream 93201 9638142 ~ 9647564 (-)
CI01000030_09683547_09689191 NA coding upstream 137358 9682299 ~ 9689387 (-)
CI01000030_09698618_09704345 NA coding upstream 153656 9698597 ~ 9704405 (-)
G164092 NA non-coding downstream 3659 9540767 ~ 9541062 (-)
G164084 NA non-coding downstream 5525 9517539 ~ 9539196 (-)
G164076 NA non-coding downstream 44848 9499417 ~ 9499873 (-)
G164074 NA non-coding downstream 51118 9493326 ~ 9493603 (-)
G164072 NA non-coding downstream 57542 9486466 ~ 9487179 (-)
G163807 NA non-coding upstream 2354 9547295 ~ 9727420 (-)
G164097 NA non-coding upstream 10700 9555641 ~ 9556172 (-)
G163760 NA non-coding upstream 84959 9629900 ~ 9635162 (-)
G163784 NA non-coding upstream 181664 9726605 ~ 9847985 (-)
G163684 NA non-coding upstream 188771 9733712 ~ 9805881 (-)
G164071 NA other downstream 68457 9475188 ~ 9476264 (-)
G163873 NA other downstream 610739 8933413 ~ 8933982 (-)
CI01000030_08185866_08194632 NA other downstream 1352235 8184897 ~ 8197266 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other downstream 1752339 7788797 ~ 7792198 (-)
CI01000030_10103451_10131419 NA other upstream 570574 10102944 ~ 10133765 (-)
CI01000030_10343879_10366274 NA other upstream 820476 10343865 ~ 10366508 (-)
CI01000030_11494792_11495184 CTXN1 other upstream 1949397 11494183 ~ 11495854 (-)

Expression



Co-expression Network