G162365



Basic Information


Item Value
gene id G162365
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 10650424 ~ 10650871 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU184395
AGCCAAGAGCAAAGAAATAAACCAGAACTGGACCTTATCTGATCCACAAAATCTTTATATATTATTTATAGAGTCATCTCAGCATTAACAAGCCTGTTATCAAGCAGAATCGCTGAAGGAAAGAAGAAAAAAAAAGAGACGAGCAGAAATACAAGAACTACAACTGACTTCAGCCACAGCCTTAGATGAAATCAACTGAAGATAAATGACATTAAATCTCTGAAGATCTGATTAAAAAACTCCACAAACAGCATTACCAGCTTCACTTATTACTAACCAGACTGACTTTATTTCTGTCACACGTCTACAGAAGTTCTTATTAAGAATTAACAGAAGTTTAACTCTCATGTTTGTTTCATTTGAGGTTACCATGATGGTGATTGATGTTTCCATTAGTTGGCTGTTTTATTTCTTTGCTCTTGGCTGACATGTGGCATGTCTATTGCCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU184395 True 448 lncRNA 0.35 1 10650424 10650871

Neighbor


gene id symbol gene type direction distance location
CI01000030_10646148_10649874 NA coding upstream 487 10645873 ~ 10649937 (+)
CI01000030_10642268_10643835 NA coding upstream 6110 10642268 ~ 10644314 (+)
CI01000030_10628602_10631875 BCDIN3D coding upstream 18312 10628602 ~ 10632112 (+)
CI01000030_10605608_10626845 CERS5 coding upstream 23146 10603370 ~ 10627278 (+)
CI01000030_10596446_10602032 NA coding upstream 46787 10596217 ~ 10603637 (+)
CI01000030_10664189_10683103 MCM2, MCM2.L coding downstream 12513 10663384 ~ 10683381 (+)
CI01000030_10689813_10702377 NA coding downstream 38577 10689448 ~ 10702993 (+)
CI01000030_10716988_10729316 NA coding downstream 65558 10716429 ~ 10729662 (+)
CI01000030_10738658_10751094 NA coding downstream 87216 10738087 ~ 10751548 (+)
CI01000030_10753303_10762765 NA coding downstream 102432 10753303 ~ 10762765 (+)
G162722 NA non-coding upstream 8391 10641805 ~ 10642033 (+)
CI01000030_10537146_10539791 NA non-coding upstream 26616 10536191 ~ 10540258 (+)
G162694 NA non-coding upstream 86107 10522304 ~ 10564317 (+)
G162366 NA non-coding upstream 134608 10513888 ~ 10515816 (+)
CI01000030_10473378_10509560 NA non-coding upstream 139365 10471835 ~ 10511071 (+)
G162379 NA non-coding downstream 17528 10668399 ~ 10668676 (+)
G162356 NA non-coding downstream 17950 10668821 ~ 10669837 (+)
G162306 NA non-coding downstream 54050 10704921 ~ 10712174 (+)
G162793 NA non-coding downstream 137896 10788767 ~ 10789149 (+)
G162794 NA non-coding downstream 142939 10793810 ~ 10794162 (+)
G162297 NA other upstream 429200 10133299 ~ 10221224 (+)
CI01000030_10039688_10047019 NA other upstream 604541 10039358 ~ 10047210 (+)
G162449 NA other upstream 1293410 9356403 ~ 9357014 (+)
G162137 NA other upstream 2078698 8568010 ~ 8571726 (+)
G162821 NA other downstream 215141 10866012 ~ 10868440 (+)
CI01000030_11362386_11380216 CALR3A, CALR3, CALR3B other downstream 689884 11362114 ~ 11380772 (+)
G162951 NA other downstream 841730 11492601 ~ 11496119 (+)

Expression



Co-expression Network