G176649



Basic Information


Item Value
gene id G176649
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 3909615 ~ 3909911 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU200643
GTCATCCGCCGGTGCTCCGAAAGAAACGGCTGATCGCTCCGTAGAGGGAACAGCACACTCAGTCGGCAACACCACCGGTTGCAGTGAGGTAGAGGGGACAGGGGCCCGCGGAGCGGTGCTCGGCGGGGAAGCCCTGACCGTGATCCTCAGATCACCCTGCCTACACGCCGACGCACCGTCACCCCGGCCGAAGCCAGAGAAAACGGCGGAACGGGGCATAGGGGAGGGGACCCCCGCTCCCTGAGAACCAAGGAACGAGAGTCTCGATCTCAACACTGCAATAGTCATGTTCCCACA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU200643 True 297 lncRNA 0.63 1 3909615 3909911

Neighbor


gene id symbol gene type direction distance location
CI01000037_03901647_03902747 NA coding upstream 6868 3899399 ~ 3902747 (+)
CI01000037_03875808_03891566 NA coding upstream 17228 3875488 ~ 3892387 (+)
CI01000037_03855991_03860283 UBE2A.L, UBE2A, UBE2B, UBE2AL, BRAFLDRAFT_128294 coding upstream 48314 3855991 ~ 3861301 (+)
CI01000037_03824405_03854894 ANKRD10B coding upstream 54421 3824208 ~ 3855194 (+)
CI01000037_03811261_03823037 CARKD coding upstream 86500 3811261 ~ 3823115 (+)
CI01000037_03946645_03954021 SIK1 coding downstream 36084 3945995 ~ 3954314 (+)
CI01000037_04050140_04050646 NA coding downstream 139254 4049165 ~ 4050883 (+)
CI01000037_04061560_04065802 NA coding downstream 151649 4061560 ~ 4066041 (+)
CI01000037_04080145_04081691 NA coding downstream 168570 4078481 ~ 4082806 (+)
CI01000037_04168194_04170478 NA coding downstream 258283 4168194 ~ 4171137 (+)
G176636 NA non-coding upstream 40610 3868798 ~ 3869005 (+)
G176635 NA non-coding upstream 41185 3868213 ~ 3868430 (+)
G176633 NA non-coding upstream 42495 3866842 ~ 3867120 (+)
G176554 NA non-coding upstream 352233 3557182 ~ 3557382 (+)
G176510 NA non-coding upstream 363865 3545289 ~ 3545750 (+)
G176652 NA non-coding downstream 4039 3913950 ~ 3915351 (+)
G176519 NA non-coding downstream 21070 3930981 ~ 4010044 (+)
G176672 NA non-coding downstream 109536 4019447 ~ 4019931 (+)
G176673 NA non-coding downstream 110536 4020447 ~ 4020837 (+)
G176679 NA non-coding downstream 123344 4033255 ~ 4033487 (+)
G176377 NA other upstream 821647 2976862 ~ 3087968 (+)
G176346 NA other upstream 1069562 2839760 ~ 2840053 (+)
CI01000037_01965864_01966433 COA5, CB064 other upstream 1939224 1965603 ~ 1966435 (+)
G174949 NA other upstream 2295341 1613876 ~ 1614274 (+)
CI01000037_04213179_04218057 NA other downstream 303372 4212907 ~ 4218305 (+)

Expression



Co-expression Network