G183603


Basic Information

Item Value
gene id G183603
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 357433 ~ 357675 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU208500
GAATATCATCAAAAAGTTGATTTATTTCACTAATTCTATTCAAAAAGTGAAACTTGTATATTATATTCATTCATTACACACAGACTGATATATTTCAAATGTTTATTTCTTTTAATTTTGATGATTATAACTGACAACTAAGGAAAATCCCAAATTCAGTATCTCAGAAAATTAGAATATTGTGAAAAGGTTCAATATTGAAGACACCTGGTGCCAAACTCTAATCAGCTAATTAACTCAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU208500 True 243 lncRNA 0.26 1 357433 357675

Neighbor

gene id symbol gene type direction distance location
CI01000040_00347516_00350540 NA coding upstream 6832 347516 ~ 350601 (+)
CI01000040_00240852_00305487 GABRB2 coding upstream 51946 240849 ~ 313275 (+)
CI01000040_00178642_00181455 NA coding upstream 175242 178604 ~ 182404 (+)
CI01000040_00366809_00384965 NA coding downstream 9034 366709 ~ 385259 (+)
CI01000040_00512880_00513451 NA coding downstream 155205 512880 ~ 513597 (+)
CI01000040_00554753_00561571 NA coding downstream 197078 554753 ~ 562993 (+)
CI01000040_00643738_00689792 STK32B, STK32A coding downstream 286063 643738 ~ 689918 (+)
CI01000040_00839831_00841736 NA coding downstream 482156 839831 ~ 841736 (+)
G183465 NA non-coding upstream 10519 346374 ~ 346914 (+)
G183459 NA non-coding upstream 20400 336819 ~ 337033 (+)
G183456 NA non-coding upstream 24788 332419 ~ 332645 (+)
G183421 NA non-coding upstream 104071 201052 ~ 253362 (+)
G183628 NA non-coding downstream 22446 380121 ~ 380449 (+)
G183630 NA non-coding downstream 22933 380608 ~ 397139 (+)
G183649 NA non-coding downstream 41358 399033 ~ 399304 (+)
G183650 NA non-coding downstream 41987 399662 ~ 399893 (+)
G183705 NA non-coding downstream 91565 449240 ~ 449601 (+)
G183420 NA other upstream 192511 157543 ~ 164922 (+)
G183366 NA other upstream 297036 53691 ~ 60397 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other downstream 616438 977184 ~ 978163 (+)
G184003 NA other downstream 872617 1230292 ~ 1236489 (+)
G185296 NA other downstream 2975903 3333578 ~ 3333983 (+)
G185884 NA other downstream 3381312 3738987 ~ 3739281 (+)
G185947 NA other downstream 3616090 3973765 ~ 3974123 (+)

Expression


Co-expression Network