Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_009415

Basic Information

Item	Value
gene id	XLOC_009415
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007126.7
NCBI id	CM002899.2
chromosome length	48040578
location	36421591 ~ 36437846 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00018839
CCTGTAGGCAAAGGTGTTACTCCTCAGCTACATTACAGTGCCAAAATAACACTTACCCCGAGGGTGCCGTCCGTGCCCTTTCTAACGGATTTTACAGCTGAAGTCAGCAAAGGTCTTAAGGGAGAAAAAGGATCCTCTTATCTTCAAATAGGTCATGTCCCATGTTCCAGGATCTAAACTTGGCAGTTCTCTGATTGGTTTTGAGATTGAGATAATAGGTATT

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00018839	True	223	lncRNA	0.43	2	36421591	36437846

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_009414	si:dkey-23k10.3	coding	downstream	51848	36358144 ~ 36369743 (-)
XLOC_009413	si:dkey-23k10.5	coding	downstream	63702	36349009 ~ 36357889 (-)
XLOC_009412	si:dkey-23k10.2	coding	downstream	73696	36329368 ~ 36347895 (-)
XLOC_009411	ostn	coding	downstream	172504	36228835 ~ 36249087 (-)
XLOC_009410	col4a4	coding	downstream	366190	35951888 ~ 36055401 (-)
XLOC_009416	NA	coding	upstream	62360	36500206 ~ 36503189 (-)
XLOC_009417	si:dkey-262k9.4	coding	upstream	68168	36506014 ~ 36533437 (-)
XLOC_009418	nphs1	coding	upstream	115977	36553823 ~ 36939655 (-)
XLOC_009419	NA	coding	upstream	346633	36784479 ~ 36784773 (-)
XLOC_009420	AL953844.1	coding	upstream	436405	36874251 ~ 36874366 (-)
XLOC_009407	NA	non-coding	downstream	535218	35761681 ~ 35886373 (-)
XLOC_009408	CR854907.1	non-coding	downstream	640786	35780040 ~ 35780805 (-)
XLOC_009406	NA	non-coding	downstream	745606	35614234 ~ 35675985 (-)
XLOC_009404	CR848683.2	non-coding	downstream	760223	35414466 ~ 35661368 (-)
XLOC_009405	CR848683.1	non-coding	downstream	952791	35440740 ~ 35468800 (-)
XLOC_009422	CR848749.2	non-coding	upstream	821508	37259354 ~ 37264265 (-)
XLOC_009432	CR848836.1	non-coding	upstream	1289988	37727834 ~ 37729166 (-)

Expression

Co-expression Network