G197822


Basic Information

Item Value
gene id G197822
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 6569600 ~ 6569867 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU224539
TCAATGGTCGTCTTTTGGACAACTGTCAAGTCAGCAGTCTTCCCCATGATTGTGTAGCCTACAGAACTAGACTGAGAGACCATTTAAAGGCCTTTGCAGGTGTTTTGAGTTAATTAGCTGATTAGAGTGTGGCACCAGGTGTCTTTAATATTGAACCTTTTCACAATATTCTAATTTTCTGAGATACTGAATTTGGGATTTTCCTTAGTTGTCAGTTATAATCATCAAAATTAAAAGAAATAAACATTTGAAATATATCAGTCTGTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU224539 True 268 lncRNA 0.35 1 6569600 6569867

Neighbor

gene id symbol gene type direction distance location
CI01000046_06553680_06556870 NA coding upstream 11875 6552326 ~ 6557725 (+)
CI01000046_06489840_06506540 TUBG1, TUBG1.L, TUBG2 coding upstream 61993 6489620 ~ 6507607 (+)
CI01000046_06465424_06470835 SCPEP1 coding upstream 98606 6465424 ~ 6470994 (+)
CI01000046_06362326_06364947 NA coding upstream 204516 6361790 ~ 6371457 (+)
CI01000046_06330849_06347081 CRLF3 coding upstream 222221 6330849 ~ 6347379 (+)
CI01000046_06586111_06594100 CNTNAP1 coding downstream 16244 6586111 ~ 6594182 (+)
CI01000046_06605188_06611590 SLC16A6B coding downstream 35321 6605188 ~ 6611714 (+)
CI01000046_06617493_06617792 NA coding downstream 47626 6617493 ~ 6618531 (+)
CI01000046_06653842_06661599 NA coding downstream 83975 6653842 ~ 6661648 (+)
CI01000046_06754054_06769901 NA coding downstream 184187 6754054 ~ 6770272 (+)
G197721 NA non-coding upstream 86602 6482106 ~ 6482998 (+)
G197718 NA non-coding upstream 90267 6478948 ~ 6479333 (+)
G197719 NA non-coding upstream 92889 6476302 ~ 6476711 (+)
G197717 NA non-coding upstream 100717 6468501 ~ 6468883 (+)
G197702 NA non-coding upstream 139965 6427844 ~ 6429635 (+)
G197824 NA non-coding downstream 1468 6571335 ~ 6571550 (+)
G197826 NA non-coding downstream 4697 6574564 ~ 6574773 (+)
G197827 NA non-coding downstream 5662 6575529 ~ 6575797 (+)
G197755 NA non-coding downstream 103793 6673660 ~ 6675496 (+)
G197875 NA non-coding downstream 216051 6785918 ~ 6786281 (+)
G197528 NA other upstream 826916 5726121 ~ 5742684 (+)
G197352 NA other upstream 1293147 5259318 ~ 5276453 (+)
G196869 NA other upstream 2147913 4415530 ~ 4421687 (+)
G197121 NA other upstream 2198170 4371011 ~ 4371430 (+)
G197055 NA other upstream 2419820 4149423 ~ 4149780 (+)
CI01000046_06808895_06820945 GSPT1, ERF3B, GSPT1L other downstream 250071 6808507 ~ 6821543 (+)

Expression


Co-expression Network