G210177


Basic Information

Item Value
gene id G210177
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 7912130 ~ 7912345 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU238431
CTTAAAATAATTTTTGTATATTTATATATAATATACATTAGGGGTGGGAGAGAAAAAAATCGATCCATTGATGCATCGCGATTCTCTCTCCGACGATTCCGGATCGATTCTGAGAATTTTAGAATCGATTCTGAGCTTATAGTTTTTAACGAGATGAGCGATGACGCCGAGTGTGCTTTTGAAACACCCGGATTCTGCTTGCTTCCAATTCCTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU238431 True 216 lncRNA 0.38 1 7912130 7912345

Neighbor

gene id symbol gene type direction distance location
CI01000049_07881589_07906998 NA coding upstream 4229 7881589 ~ 7907901 (+)
CI01000049_07855958_07856965 NA coding upstream 54234 7855326 ~ 7857896 (+)
CI01000049_07799740_07805784 NA coding upstream 106346 7799740 ~ 7805784 (+)
CI01000049_07788293_07793674 NA coding upstream 118435 7788293 ~ 7793695 (+)
CI01000049_07735779_07751747 TCIRG1A coding upstream 160383 7735779 ~ 7751747 (+)
CI01000049_07919606_07935459 SLC43A1B coding downstream 7261 7919606 ~ 7935585 (+)
CI01000049_07940922_07947928 TMX2B, TMX2 coding downstream 28577 7940922 ~ 7948246 (+)
CI01000049_07972199_07972908 NA coding downstream 59698 7972043 ~ 7973140 (+)
CI01000049_08032079_08038636 CRYBA1L1, CRYBA1L2 coding downstream 119149 8031494 ~ 8039109 (+)
CI01000049_08106860_08114028 SLC43A3A coding downstream 193945 8106290 ~ 8114745 (+)
G210164 NA non-coding upstream 61996 7849512 ~ 7850134 (+)
G210163 NA non-coding upstream 62633 7849201 ~ 7849497 (+)
G210162 NA non-coding upstream 62947 7848894 ~ 7849183 (+)
G210151 NA non-coding upstream 85595 7826278 ~ 7826535 (+)
G210142 NA non-coding upstream 97602 7814267 ~ 7814528 (+)
G210202 NA non-coding downstream 71918 7984263 ~ 7985939 (+)
G210205 NA non-coding downstream 78575 7990920 ~ 7991279 (+)
G210211 NA non-coding downstream 98830 8011175 ~ 8011480 (+)
G210217 NA non-coding downstream 104956 8017301 ~ 8017535 (+)
G210130 NA non-coding downstream 133488 8045833 ~ 8049024 (+)
G210091 NA other upstream 33274 7873750 ~ 7878856 (+)
CI01000049_07219171_07224229 NA other upstream 615068 7218811 ~ 7224268 (+)
G209660 NA other upstream 1030100 6878133 ~ 6882030 (+)
CI01000049_04473766_04475768 GM10043, LSM6, SNRPF, BRAFLDRAFT_125735 other upstream 3435860 4473662 ~ 4476270 (+)
G208074 NA other upstream 4029919 3877396 ~ 3882211 (+)
CI01000049_08326623_08329601 NA other downstream 415607 8326285 ~ 8329915 (+)

Expression


Co-expression Network