CI01000050_04291776_04301169 (RAB7A, RAB7)


Basic Information

Item Value
gene id CI01000050_04291776_04301169
gene name RAB7A, RAB7
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 4291757 ~ 4301169 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000050_04291776_04301169.mRNA
ATGGCTTCTCGTAAGAAGGTGCTGCTCAAAGTGATCATCCTAGGGGATTCTGGAGTTGGGAAGACCTCTTTGATGAACCAGTATGTGAATAATAAGTTCAGCAATCAGTATAAGGCCACTATCGGAGCCGACTTCCTGACCAAGGAGGTGATGGTGGACGACAGACTGGTCACCATGCAGATTTGGGACACAGCAGGTCAGGAGCGGTTTCAGTCTCTGGGCGTGGCTTTCTACAGAGGGGCGGACTGTTGCGTGCTGGTCTATGATGTCACGGCACCCACTACATTTAAGACTATGGACAGCTGGAGGGATGAGTTTCTCATTCAGGCCAGTCCACGTGACCCGGAGAACTTCCCCTTTGTTGTGCTGGGAAACAAAATCGACCTGGAGAACCGACAGGTAACAACAAAGCGGGCACAAGCATGGTGTCAGAGTAAGAACAACATCCCCTATTTTGAGACCAGTGCCAAAGAAGCCATTAACGTGGACCAGGCCTTCCAAACCATTGCTCGCAATGCACTTAAACAGGTAGAGAAAGTTGACAATACTTCAGATTGATTTCAGAATTGCAATTAAA

Function

symbol description
rab7a Predicted to enable GTP binding activity and GTPase activity. Acts upstream of or within endosomal transport. Located in late endosome. Is expressed in neural crest. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease type 2B. Orthologous to human RAB7A (RAB7A, member RAS oncogene family).
rab7 Predicted to enable several functions, including guanyl ribonucleotide binding activity; retromer complex binding activity; and small GTPase binding activity. Involved in lipophagy. Acts upstream of or within with a positive effect on establishment of vesicle localization. Located in several cellular components, including late endosome membrane; lipid droplet; and phagophore assembly site membrane. Is extrinsic component of lysosome membrane. Is active in lysosome. Is expressed in limb mesenchyme and lung mesenchyme. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease type 2B. Orthologous to human RAB7A (RAB7A, member RAS oncogene family).

GO:

id name namespace
GO:0005811 lipid droplet cellular_component

KEGG:

id description
K07897 RAB7A; Ras-related protein Rab-7A

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000050_04291776_04301169.mRNA True 577 mRNA 0.49 4 4291757 4301169

Neighbor

gene id symbol gene type direction distance location
CI01000050_04247305_04272766 NA coding downstream 18991 4247044 ~ 4272766 (-)
CI01000050_04208939_04225972 ACSL2 coding downstream 65785 4208939 ~ 4225972 (-)
CI01000050_03916668_03927175 NA coding downstream 364582 3914370 ~ 3927175 (-)
CI01000050_03798634_03799395 NA coding downstream 492362 3798615 ~ 3799395 (-)
CI01000050_03776675_03777031 NA coding downstream 514542 3776584 ~ 3777215 (-)
CI01000050_04442645_04542984 BMP1A, BMP1 coding upstream 141246 4442415 ~ 4543263 (-)
CI01000050_04564233_04580815 KANSL3 coding upstream 262967 4563687 ~ 4581278 (-)
CI01000050_04702299_04703455 NA coding upstream 401074 4702243 ~ 4703455 (-)
CI01000050_04732489_04733933 NA coding upstream 430817 4731986 ~ 4733933 (-)
CI01000050_04781467_04784451 NA coding upstream 479834 4781003 ~ 4784587 (-)
G215034 NA non-coding downstream 13165 4275872 ~ 4278592 (-)
G215119 NA non-coding downstream 113196 4142868 ~ 4178561 (-)
G215121 NA non-coding downstream 146624 4143788 ~ 4145133 (-)
G215113 NA non-coding downstream 148508 4134378 ~ 4143249 (-)
G215106 NA non-coding downstream 173592 4117358 ~ 4118165 (-)
G215188 NA non-coding upstream 35925 4337094 ~ 4337399 (-)
G215189 NA non-coding upstream 37306 4338475 ~ 4339066 (-)
G215193 NA non-coding upstream 51627 4352796 ~ 4401851 (-)
G215209 NA non-coding upstream 82503 4383672 ~ 4400172 (-)
G215220 NA non-coding upstream 249885 4551054 ~ 4582222 (-)
G214436 NA other downstream 702700 3525816 ~ 3589057 (-)
CI01000050_03491159_03514757 NA other downstream 780966 3491088 ~ 3514757 (-)
G214314 NA other downstream 867500 3413448 ~ 3424257 (-)
G214027 NA other downstream 1718855 2557166 ~ 2572902 (-)
G214017 NA other downstream 1827059 2462176 ~ 2464698 (-)
G215935 NA other upstream 747747 5048916 ~ 5073109 (-)
G216093 NA other upstream 1188388 5489557 ~ 5552103 (-)
G216408 NA other upstream 2054848 6356017 ~ 6356511 (-)
G216931 NA other upstream 2862926 7164095 ~ 7165401 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location