G222869


Basic Information

Item Value
gene id G222869
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 127901 ~ 128156 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU252803
ATGTGTAATTTGTATTTGTGTATAGAGGGTCACCATTGATCCACTATTTTTTTTCTTTAATGAAAAACATGGTAAGTTTTGTTGAATCTATGTTAAGTTTAAATAAAAACCATTGGATTTGTTAATGAAATATGTCTCTTCATTAGTGATGTTACATTTTATTTATTTTAATGGCCTTGAAAACAAATGCATTTAACTTTGGGAAAATGTCACCTAAGTAATTTGTTAAACTGTATTTAAACAGTAGCACAATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU252803 True 256 lncRNA 0.26 1 127901 128156

Neighbor

gene id symbol gene type direction distance location
CI01000052_00061936_00072645 NA coding upstream 55235 60529 ~ 72666 (+)
CI01000052_00045445_00045867 NA coding upstream 81906 45170 ~ 45995 (+)
CI01000052_00165058_00166912 NA coding downstream 36902 165058 ~ 166935 (+)
CI01000052_00294399_00296217 NA coding downstream 165974 294130 ~ 296806 (+)
CI01000052_00430871_00437100 NA coding downstream 301577 429733 ~ 437122 (+)
CI01000052_00437783_00438718 NA coding downstream 309122 437278 ~ 438749 (+)
CI01000052_00496215_00499293 NA coding downstream 368059 496215 ~ 499724 (+)
G222866 NA non-coding upstream 8533 119004 ~ 119368 (+)
G222853 NA non-coding upstream 20205 93871 ~ 107696 (+)
G222849 NA non-coding upstream 46839 80822 ~ 81062 (+)
G222843 NA non-coding upstream 72980 54716 ~ 54921 (+)
G222870 NA non-coding downstream 1359 129515 ~ 129771 (+)
G222878 NA non-coding downstream 24861 153017 ~ 153402 (+)
G222882 NA non-coding downstream 49083 177239 ~ 182165 (+)
G222906 NA non-coding downstream 118446 246602 ~ 328614 (+)
G222964 NA non-coding downstream 204972 333128 ~ 333361 (+)
G223545 NA other downstream 1142336 1270492 ~ 1270927 (+)
G223694 NA other downstream 1921170 2049326 ~ 2104299 (+)
G224953 NA other downstream 3302980 3431136 ~ 3460136 (+)

Expression


Co-expression Network